regreso al inicio

Desahógate con tus mensajes

( click aquí para escribirlos )

Portal Cd. Juárez no es responsable de los textos que aparecen en esta página.
Portal Cd. Juárez se reserva el derecho de borrar cualquier mensaje.

vein ek ( e-mail: )
Viernes 25.07.2014 / 05:05
Ekekekekekeke vein vein blue blue fure fure los mejores de san jon tilapa jajaja

( e-mail: )
Martes 10.06.2014 / 15:33
arriva el 5 siete chino

( e-mail: )
Domingo 08.06.2014 / 12:58
todos son culos

LA SIERRA ( e-mail: )
Lunes 02.06.2014 / 08:36

Miércoles 21.05.2014 / 06:46
ajajaaja hahaha mecago de risa doblados de M... caigale al topon mierdas ATTE EL PADRE .R-8

doble a ( e-mail: )
Domingo 16.03.2014 / 13:31
Aquii el doble A Aun seguimos gente ya van saliendo los H... ones amaarrense marra nos de miierdaaa puro doble a rifandoo

no mamen ( e-mail: )
Jueves 31.10.2013 / 13:51
no mamen ase como tres años esta madre era d que barrio y barrio y k la V... aora o sorpresa ya todos sicarios no mames pinchis cholos cagados ya tdos narcotees hahahaha

puro meco aki ( e-mail: )
Jueves 31.10.2013 / 00:32
jajajaj neta que me cago de la risa puro pinche tonto aki puro meco que esta todo el dia en la computadora y escriben que son el chapo o gente del R8 de la linea jajajajajajaja mecos mejor pongase a picarse el C... o diganles asu mama que mejor les corte el internet jajajajajajajajajajajaj

Miércoles 02.10.2013 / 09:51

( e-mail: )
Martes 01.10.2013 / 11:28

alfredo rios ( e-mail: alfredito_riiozz )
Miércoles 31.07.2013 / 22:43
un saludooo para toda la plebada qeee anda al millon y no bajan bandera parientees kuiensee atodo a qel qe anda mal suerteee aii de ratoo parientes

Jueves 25.07.2013 / 14:52

( e-mail: )
Sábado 15.06.2013 / 15:56
el rap es cabron

( e-mail: )
Viernes 31.05.2013 / 11:52

( e-mail: )
Jueves 23.05.2013 / 09:51

( e-mail: )
Jueves 23.05.2013 / 06:11

( e-mail: )
Miércoles 22.05.2013 / 05:08
Hola buen día, alguien que me pueda ayudar a hacer una manta con graffiti ... solo que diga Body Combat ... ¿Quien pudiera apoyarme? Gracias. Saludos.

Snof ( e-mail: )
Lunes 13.05.2013 / 11:22

JARUDO ( e-mail: )
Lunes 13.05.2013 / 11:19

( e-mail: )
Miércoles 24.04.2013 / 13:19
De ratooo mis demonios 3 le BAA pasar la boladoraaa ya se akabo su paroo pinchis doblados kagadosss

XXXX ( e-mail: )
Lunes 15.04.2013 / 07:16

XXXXX ( e-mail: )
Lunes 15.04.2013 / 07:12

( e-mail: )
Sábado 13.04.2013 / 04:18

clavo ( e-mail: )
Domingo 07.04.2013 / 05:38
Aquino seguimos mi drekk al fiend con el chapo cds carteles unidos mexiclotes doblados y todos los pelones clan y carnales al fiend en Cd Juarez nosotros controlamos sin aserruido comemos sin ensusiarnos como nos an ensenado los maestros estamos al cien y creciendo y lo prometido es deuda se estan acabando. La's marranadas como Dijo el carnal quita puercos al fien y asta dentro la cosina es nuestra la cantina estate al cien y la borrachera sigue y aqui estamos todos los borrachos y los pelones y seguimos eborrachando como Dijon el general villa al cien la revolucion al cien miss borrachos y ask se Ase un Fancho para los caidos y la botella para los depiertos saludos a todas la's cantinas y saludos a toda la borrachera al cien y a gosarla que aora empieza lo bueno cds.

Dreeck ( e-mail: )
Jueves 28.03.2013 / 04:41

Luis ( e-mail: )
Lunes 18.03.2013 / 07:24
Que onda, alguna chava que le guste pasarla bien, no importa edad, yo chavo buena onda, atento y con buenas posibilides, dejen sus mensajes o envienme correo, bye

ROOOO ( e-mail: )
Lunes 04.03.2013 / 21:00

Haide ( e-mail: )
Sábado 02.03.2013 / 04:16
Hola!! :) estoy aplicando una encuesta para mi tesis sobre graffiti en la ciudad de Chihuahua, me ayudarían a contestar una? gracias! :D

Genesis ( e-mail: No tengo )
Jueves 17.01.2013 / 10:11
Ser mama es lo mas hermoso q me paso en la vida,despues de todo lo malo q me paso estoy tranquila de estar con mi beba.

R8*GENTE DE EL 2 AL MILL ( e-mail: )
Sábado 22.12.2012 / 19:56

clavo ( e-mail: )
Domingo 09.12.2012 / 06:18
No mamen pinches linieros la's marranadas de secuestro cuatas son pinchis rollos sullos y de los aztecas pero agarresnse Puto's.arre carnales la Verde esta de todos lados Lla no los queremos de buelta pa.el chuck ban pa bajo Puto's arre carnales tras de estos puto's ban pa bajo lla es el momentous de cobrar a estos pinches vende pa patrias aqui nos estamos preparando. No bamos a dejar ni una pinche pluma ni una linea estos putos lla se estan pasando de mas y tenemos que. Defender el canton y la mejor manera es acostar a todos loa aztecas y linieros que nadamas andan cagandola no saben camellar arres putos chicanos puro Mexico putos

( e-mail: )
Sábado 08.12.2012 / 03:49

( e-mail: )
Lunes 03.12.2012 / 15:45
Una Niña le pregunto a su novio: ¿Me quieres? Y el le contesto que no. ¿Piensas que soy linda? y el contesto que no ¿Me tienes en tu corazón?y el contesto que no. ............¿Si me fuera, llorarías por mi? y también contesto que no....Ella triste se dio media vuelta para irse y el la agarro del brazo y le dijo: ... ... ... ... ... ... ... ... ........No te quiero, TE AMO, No pienso que sos linda, pienso que eres HERMOSA, No estas en mi corazón, ERES mi corazón. No lloraría por ti, MORIRIA por ti. Hoy a media noche tú amor se va a dar cuenta de que te ama. Algo bonito te va a pasar Mañana entre la 1 y las 4 de la tarde.. Da igual donde estés: en Internet, en el colegio, en el trabajo… si rompes esta cadena tendrás mala suerte en 10 relaciones durante 10 años… Así que pega esto en 4 paginas y luego presiona F9 Aparecerá la letra inicial del chico o chica que te ama

PARA JARUDO! ( e-mail: )
Domingo 02.12.2012 / 14:38
inf jarudo un atento aviso de que vamos por ivansitoo! EL NOMY a darle piso asi que ponte trucha ! anduviste cagando el palo ! JARUDITO! eres de los pocos que faltan ya se fueron varios tu eres de los vascas que andan por hai asi que altiro mi nomi que talves esta navidad no la pases mas que comiendo tierra!

( e-mail: )
Sábado 24.11.2012 / 03:47

( e-mail: )
Jueves 22.11.2012 / 12:23
los jarudos ya no existen y los que fueron algun dia eran lambehuevos° y envidia de ke? si nunca tuvieron nada° solo que me gusta humillarlos pinchis vatos chavalotas atropellados° siempre fueron de agua° tiro por viaje los haciamos de agua°

( e-mail: )
Sábado 17.11.2012 / 05:26

( e-mail: )
Viernes 16.11.2012 / 09:50

( e-mail: )
Viernes 16.11.2012 / 09:46

clavo ( e-mail: )
Miércoles 14.11.2012 / 15:41
Metete a carrillo x el C... y a tus pinches tecatos del centro cuidalos x que memos acabado con todos puro Aa y nosotros si somos de Juarez pinched Chicano de misread as de sere un pinched azteca lambent guebos ben x una curate tecato

( e-mail: )
Lunes 29.10.2012 / 08:03

El Chapo Guzman ( e-mail: )
Viernes 19.10.2012 / 17:29
Recurden Que Para cantar se ocupa ser gallo ai muchos pollitos que quieren volar como gallo yo los traigo a todos en los huevitos soi su mero padre y su peor pesadilla JOAQUIN GUZMAN LOERA EL CHAPO GUZMAN.............

Viernes 19.10.2012 / 07:50

( e-mail: )
Jueves 18.10.2012 / 13:09

( e-mail: )
Martes 16.10.2012 / 10:14

( e-mail: )
Martes 16.10.2012 / 05:40
k tranza aki desde la tj tijuana 664 nuestra area saludos a todos los cabrones k andan en el graffiti.... saken las latas y apegar un rayon en cada espacio .....

( e-mail: )
Lunes 15.10.2012 / 06:11

( e-mail: °°°°° )
Domingo 14.10.2012 / 12:26

VIRREYES ( e-mail: fmC )
Martes 09.10.2012 / 12:31

the fowy ctwt ( e-mail: )
Martes 09.10.2012 / 06:30
cartelon 23 los cocha putas !!! C T W T

mafia unida kriminal ( e-mail: )
Viernes 05.10.2012 / 19:45
llego su P... pesadilla marikass barrio unidos 14 rifando las kalles i no hay nadie kien nos pare los del JARUDO son rekulos 9,mm,3030,357,eskopetas no te metas somos peligrosos i aki andamos trusha las armas las karga el maldito barrio unido de k pueden hablar si andan en la kalle todo pinshes asustados embidiossos pinshes OSIKONES ala V... retirese ala VERGA asiendo limpia de LEVAS barrio unidos putos de MIERDA

Jueves 27.09.2012 / 09:45

EL STHANFER ( e-mail: )
Domingo 16.09.2012 / 10:09

( e-mail: )
Viernes 14.09.2012 / 16:50

el grifo ( e-mail: )
Domingo 09.09.2012 / 14:15
arriba la marihuana .

el jl ( e-mail: )
Viernes 31.08.2012 / 13:59
parece que le dieron piso al R3 de la gente nueva, ahi por Parral, asi que el chapo controla Chihuahua...

( e-mail: )
Martes 28.08.2012 / 03:36
cuibo kien anday ....k royo jarudos como andan reportense. altiro pues karnales

( e-mail: )
Sábado 25.08.2012 / 21:49
Cleaning with all these people who are dedicated to disturb the humble people of Juarez,ubstedes que se dedicaron a amenazar, a matar sin saber si era el contra, a pedir cuota, vayan pidiendole perdón a dios por que fregaron a nuestra gente de Juarez, no saben cuantos niños huerfanos dejaron en Juarez o a cuantas familias sin deberla & temerla sacaron de Juarez... Let us think Juarez something more we do not want this for juarez. atte. Angel Black

( e-mail: )
Sábado 11.08.2012 / 19:52
bola de pinches terrosos matandose entre ustedes enserio que ni pena me dan y asi quieren ser grandes hasta P... son mejor vallanse a vender su C... en las esquinas

( e-mail: )
Viernes 03.08.2012 / 10:00

( e-mail: )
Jueves 02.08.2012 / 03:19
yya acaben con la guerra si colaboran con contras entrree ustedes,,,,,, ya terminen esto vendan droga como antes que me hace falta un pase y un toque ya no se maten mejor echen a andar esta ciudad mucho mejor que antes

clavo ( e-mail: )
Miércoles 25.07.2012 / 00:22
Disculpas a Juarez x low actors de vilencia desmedida de algunos de nuestra jente tomaremos cartas en remediar estos across nosotros no estamos en contra de la ciudad ni de el gobierno seguimos en lo ablado y aunque se a doblegado alginos acuerdos x parts de loss interesados nltodos nositros seguimos en el acuerdo x el Vienna de Juarez

el monico ( e-mail: juarez )
Sábado 21.07.2012 / 05:17
seguimos limpiando plaza, nos cargamos un par de dobleAA, y la limpieza sigue.

( e-mail: )
Domingo 15.07.2012 / 07:50
un saludo a los cnck de morelos que rayan chido y traen buen roio saludos

gonza ( e-mail: juarez )
Sábado 14.07.2012 / 19:16

( e-mail: )
Sábado 14.07.2012 / 13:39
jarudote lokos aunke les duelaaaa el kleensss.. sigue respirando mierdasssss..

Miércoles 27.06.2012 / 16:12

EL CHAPO ( e-mail: )
Viernes 22.06.2012 / 03:25

mr VERGAS ( e-mail: )
Miércoles 20.06.2012 / 07:01

BARDAS 13 ( e-mail: )
Miércoles 20.06.2012 / 06:39

BARDAS 13 ( e-mail: )
Miércoles 20.06.2012 / 06:35

M6F ( e-mail: )
Miércoles 20.06.2012 / 06:30

BARDAS 13 ( e-mail: )
Miércoles 20.06.2012 / 06:26
pinchis bolas de jotos los del chapo me pelan la V... att. bardas 13 de la generacion antigua no se confundan pendejos

( e-mail: )
Domingo 17.06.2012 / 17:25
en memoria del luiz kolocio ay andamos eres nuestro angel el k nos kuida de aya arribitaa por algo an pasado las kosas se salbaron dep PYTY

omar ( e-mail: )
Viernes 15.06.2012 / 00:41
mira pinche tecato tu y tus pinches carnales los aztecas nos pelan la V... son puros lambegubos de los linieros pero lla le cagaron la V... a los linieros x que traen puros peines y tecatos aora le fueron a pedir chichi a los z lla no la ben llegar ustedes son los que siguen callendo lo unico que les queda es el centro y ni alli los qyuieren lla llego la ora de cobrar y ni uno de los que quedan se la ban a acabar lla no bengan a desirnos que no querian pedo salgale y mueran como hombres sabian en lo que se metieron de rato y tiempo que es lo que lla no les queda.

M1DREECK ( e-mail: R8 )
Martes 12.06.2012 / 17:57

( e-mail: )
Lunes 28.05.2012 / 17:36

k putos ! ( e-mail: )
Lunes 28.05.2012 / 17:33

( e-mail: )
Lunes 28.05.2012 / 11:50
jajajajajja pendejotess

Lunes 28.05.2012 / 11:37

peña miente jaja ( e-mail: )
Lunes 28.05.2012 / 11:23
apoco si !! jajajaj me estaba cagando dela P... risa orita que vi esta pagina y la sarta de P... que ay en ella eso de que el chapo,o integrantes dela linea,, eten sentados enla computadora en el muro o en el facebook,, es la P... mas grande que eh visto jajajaja pinchy gentee babosaa netaa aysi aysi !! aqui soy narco !1 aya afuera soy un meco !! jajajajajaja bola de little chavalass cuando aya quebrada me meto aver que respoondieron babososs!! que H... ue su P... C... sidosa y sarnosa madree todo el que me leaa!!! y tambien el que se hagaa P... !! jajaja si soy apaa!! jajaay !!!

( e-mail: )
Lunes 28.05.2012 / 09:20

( e-mail: )
Lunes 28.05.2012 / 08:57
puro pinchy tiraroyo!! cuando se ha sabido que un pinchy narco ande perdiendo el tiempo en la computadora nomamen o escribiendo asi como pinchyes emos que en lugar de ** que *** pongan ke o esas peendejadas nosean mamoness jkajkajkajkajkajka nomas les falta poner caritas :) jkajkajkajkajkajkajkajk nomameen pinchy gentee babosaa netha.. !! y el dreeck ese wey chance y si se aviente uno que otro jalesiyo pero tampoco que no mame... esmas ese wey antes era campaa creo weno si si es el que creo si le aca pelonciyo que se juntaba con el fresh,,bueno de ayi en mas los otros wueyes han de ser puro pinchye vato sin que hacer se pasan de verguotas o han de ser de esos pendejiyos del silencio o delos mexicles que acaban de aprender a usar la compu y ya andan cagando el palo...

( e-mail: )
Martes 22.05.2012 / 09:49
Hola soy camilaaaaaaaaaaaaaaaaaaaaaa

( e-mail: )
Martes 15.05.2012 / 17:44
no se ke pelan pinchis tontos ponganse a travajar C... aviendo tanto trabajo cuando los maten dejen pal pantion de perdida ay andan sus familiares vendiendo la casa pa enterrarlos

pipi ( e-mail: )
Martes 15.05.2012 / 02:49
culos todos los del los de los burritos guille

EL CHAPOA ( e-mail: )
Lunes 14.05.2012 / 18:08
los mugrosoZ olos linieros sirven para 2 cosas para nada i nada salganle alas ranas o altopon del cds o carteles unidos los mugrosoZ linieros no son nada les arrannkare los wuebos cabrones iselos are ke selos tragen atte SUMERO PADRE EL CHAPO AKI SIGO EN JUAREZ BUSKENME

Te vale venga ( e-mail: )
Sábado 12.05.2012 / 11:27
Aki el ke era la venga en México y en Juárez era carrillo pinche chapo traisionero no vale pandita pura venga no le llega ni a los pies aki Juárez rifa x siempre los soldados van estructura firmes aunke los marranos tengan ambre

( e-mail: )
Domingo 06.05.2012 / 12:06

( e-mail: )
Viernes 04.05.2012 / 07:07
poko a poko ban biendo el kolor del jarudo ai bamos por ustedes perros kuidesen

Miércoles 02.05.2012 / 16:37

smile ( e-mail: )
Domingo 22.04.2012 / 15:10
primero ninas y aora periodistas estos linieros lla no saben que aser para que los dejen camellar pero se les acabo el conflakes cabaron su tumba a ustedes politicos enconchados mugrosos enramflados y sombis que les siguen los politicos se les boltearion los aztecas los traicionaron y los sombis lla despertaron x todos lados an atraido maldicion juarez titeres mueran lla...........

( e-mail: )
Jueves 19.04.2012 / 05:23

skoR1 ( e-mail: )
Miércoles 18.04.2012 / 21:30
APOKO SYY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

. ( e-mail: )
Sábado 14.04.2012 / 20:44
sigo al mando morire de viejo bola de mantenidos lacras y wuebones si de mi dinero an comido perros montoneros chamakos cagados io les enseñare como pensar i hacer las cosas antes de realisarlas pronto veran el juguete nuevo que compre me costo muchos millones de dolares pero moriran todos los ratas de juares y tamaulipas. EL CHAPO.

( e-mail: )
Sábado 14.04.2012 / 08:45
ai compitaaa le apuesto q tiene como 12 o 13 años por q dise puras P... y le apuesto q usted ni tira ni barrioo toabaia juega cn carritos,,..!!! mejor no diga nada.. ATTE JARUDO LKS..!!!

( e-mail: )
Viernes 13.04.2012 / 19:19
todos los jarudos son jotos una bola de mamones lambehuevos. son muchos pero re culos cuando andan solitos se esconden en las faldas de sus mamis. nostros somos pocos pero locos. a la V... la muerte enseñales un pedaso de carne acabado de cortar y les da vomito y miedo pinchis vatos chavalotas.

( e-mail: )
Viernes 13.04.2012 / 14:24
el cartel sinalo es el cartel de las tracciones no respetan la tregua,,..!!!

( e-mail: )
Viernes 13.04.2012 / 13:51
si chapo sigue hablando me bas a kortar la berga pero a pura mordidas M... ojala k andes aki para darte ya kuello

( e-mail: )
Jueves 12.04.2012 / 15:02

SI ( e-mail: )
Lunes 09.04.2012 / 09:34

AKI SIGO EN JUAREZ ( e-mail: )
Domingo 08.04.2012 / 23:24
como les dije mugroso alos de zacatecas y austedes tambine mucho les falta para ser como yo yebo mas de 30 años al mando i aun seguire mugrosos limpia vidrios i mismo les boi a corta el pescueso acuerdense que miraran mi rostro i mis ojos antes de morires cabroones shamakos P... piojosos ATTE EL CHAPO GUZMAN

( e-mail: )
Sábado 07.04.2012 / 06:15
un saludo para mi carnale k estan tirando cana en el topo y cada bes k sale salen lokos . -----

( e-mail: )
Viernes 06.04.2012 / 22:28
De sinaloa hasta chihuahua JL ha controlado hay un grupo de sicarios por todos muy afamados ellos son el grupo linces que al JL andan cuidando La linea se esta extendiendo por toditos los estados de chihuahua a sinaloa han sido muy respetados ay le mando este corrido para estos gallos jugados mucho cuidado pariente no se vayan a metar la linea esta vigilando con armas de alto poder un saludo pal 14 valiente a mas no poder (y ay le va pariente y echele mi compa y arriba CD.juarez) En puros carros blindados la gente se anda meneando andan vigilando a todos a los que andan trabajando la linea ya no perdona a los que se andan pasando ya con esta me despido ya me voy pa la frontera un saludo pa los linces y tambien para el pariente cuiden bien al JL y estamos al 100 mi gente.

( e-mail: )
Viernes 06.04.2012 / 22:25
el chapo no durara mucho es humano se va acabar !

( e-mail: )
Jueves 05.04.2012 / 18:42

la linea ( e-mail: )
Miércoles 04.04.2012 / 00:28

( e-mail: )
Martes 03.04.2012 / 13:58

GENTE NUEVA ( e-mail: )
Domingo 01.04.2012 / 21:40

nopaleros ( e-mail: )
Domingo 01.04.2012 / 12:41
bola de ignorantes simios come vergas. chikali rifa culer0s come huevos la 13 de mexicali para todas los homies zarrapastrozos no chance a las levas indijenas como ustedes locos

PRM ( e-mail: BORRACHOS )
Viernes 30.03.2012 / 15:13

LOS JARUDO VIVEN ( e-mail: )
Viernes 30.03.2012 / 09:40

Sábado 24.03.2012 / 01:42

zona km.14 ( e-mail: aeropuerto )
Jueves 22.03.2012 / 13:37
Naaa en pinchi VIRREYES no hay nada . Es un pueblo fantasma . ke H... ados vas a limpiar .... si no hay mugre. Ya barrieron con todo.

Miércoles 21.03.2012 / 08:40
Barrio Bules.... pinchis macuarros de juarez ojala pudieramos ensenarles como c asen las cosas parecen P... con tantas M... parecen ninas con pistolas.jajaja no tiren royo x k no valen veerga nadie estan unidos son grupos de 30 ninitas y c estan matando pobres P... tienen M... de cerebro

solitarote ( e-mail: bjl no more )
Miércoles 21.03.2012 / 04:10
pa los carnales del jarudo kiero saber a cuantos les an tumbado y k barrios estan entrados,kiero saber si andan x ai el oso,nomi,toto,duke,maiko,pancho,cuco,tata,gringo,kem,gordo,zona,keff saludos desde cali

sicario ( e-mail: )
Lunes 19.03.2012 / 20:34
atu puata madre tambien

( e-mail: )
Sábado 17.03.2012 / 21:14

GENTE NUEVA ( e-mail: )
Viernes 16.03.2012 / 05:46
nose me asusten enfermos que aki ai mucha enfermedad i el virus es contagioso i todo estamos infectados.ibien enfermos de la mente

Chapitos ( e-mail: )
Viernes 16.03.2012 / 05:37
chapos y mayos rondando por las ciudad de chiwuas andamos buscando el tope i calentando la plaza ya que los linieros no le quieren salir al tope porque nos tienen miedo CDS DOBLADOS GENTE NUEVA borrando linias y buskando azcagadas.ya tenemos barios puntos i sectores hubicado arre putos ailebas el topon...

Jueves 15.03.2012 / 12:51
SIGIMOS AL 1000 RAZA ATTE CARTEL DE JUAREZ CDJ AZTECAS_______________________________________________________________RESPETA JUAQUIN LA MANO QUE TE DIO DE COMER ATTE CARTEL DE JUAREZ aztecas_______________________

iripan ( e-mail: )
Lunes 12.03.2012 / 13:51
me canso de mis amigos

ehh mija°!° ( e-mail: )
Viernes 09.03.2012 / 18:09
esa de la vagina mojada deje su numero pa darle unas buenas cochadas°!° y pa matarle el cochino°!°

( e-mail: )
Jueves 08.03.2012 / 13:16
Ya tengo a barios mokosos del 2aa nomas lo uniko k saben aser es robar celulares karros i asta un chikleeee se keman ai los tengo ubikados yaa señor usteddd nomas deme la orden

( e-mail: )
Miércoles 07.03.2012 / 08:11
un saludo para el jefe de la colonia del carmen de part de joselin

daniela ( e-mail: )
Lunes 05.03.2012 / 21:43

( e-mail: )
Lunes 05.03.2012 / 16:41
fuiste AZCACA ?? pues por eso eres asi de C... miedoso collon. por eso te saliste de ellos porque te diste cuenta que esos putos son culos. hiciste muy bien en alejarte de ellos.

( e-mail: )
Lunes 05.03.2012 / 08:17
leean la biblia brodiss hay un ser ke prometio estar kn nosotros todos los dias del mundo y nos ama km nadiee el rescata y cambia vidas creeanmelo yo era azteca y cuando mire qe mi familia esta priero me di cuenta qe en esta vida se paga todoo lo ke asemos tarde o tempranooo pro hay alguien ke nos perdonaa y el nunka se aleja de nostros DIOS ES AMOR!!!

( e-mail: )
Lunes 05.03.2012 / 04:53
hay nosvemos pues....

Swk ( e-mail: )
Lunes 05.03.2012 / 03:49
Por lo k veo puro chavo pendejero nadamas peliandose x un pinche pedasoo de terreno y una miseria de dolares k muy apenas les alcanza pa tragar sobrebibir y matar creen k eso bale su bida y al final de cuenta se ban a ir al infierno ponganse vergas chavos si enverdad les importa su vida no creo k chapo valla y los salbe ni los linieros los buenos son los k se estan inchando a costillas de ustedes jajajjajaja pa los k no isieron caso los veo en el infierno.

( e-mail: )
Domingo 04.03.2012 / 20:08
jajaj este chabo que jaja poniendo cansiones jaja nono andan mal echenle ganas pendego la linea firme llegamos estamso y estaremos atte la LINEA de el estado de chihuahua

cdsXxXXx ( e-mail: )
Domingo 04.03.2012 / 12:19
vestido de militar i al mando de mucha gente asi anda el chapo guzman por la sierre juarenze no lo an podido agarrar le temen mas que ala muerte nomas de oirlo mentar casi les pega diabetes es muy grande su poder esta mas que conprovado su gente que anda con el son civiles y soldados train aramas de alto poder que muy pocos an usado le temen mas que alucifer asi que tengan cuidados son muchos los que lo buscan son ma slo que los protegen la sierra de punta apunta son los terrenos del gefe ciudades pueblos i rutas tambien controla su gente si tienen una pregunta agansela al de los leentes no ai nada que discutir EL CHAPO sigue rifando su gente simpre anda el 1000 onde quiera trabajando el polvo i el canabis se sigue diario exportando los grengos no tienen fin siguen i siguen comprando es muy astuto el señor no cabe la menor duda se les fugo de prision oi disfruta su fortuna al diablo la extradiccion me pelan la dentadura le dijo afox y bush el señoron de la tuna son muchos los que los b

Sicario New People ( e-mail: )
Jueves 01.03.2012 / 04:31
que onda putos ya estan listo para ponerlos de buche i cortarles el pescueso recuereden que me gusta arrankarles el cuero de la cara putos y degollarles el cuello antes de matarlos les arranco los huevos yasaven como seles sale el aire por el cuello cuando los decapito sobre todo cortartele el hueso de la espina dorsal es lo que mas me gusta.CDS

PRM ( e-mail: BORRACHOS )
Miércoles 29.02.2012 / 17:21

CDJ ( e-mail: )
Miércoles 29.02.2012 / 16:18

r12 ( e-mail: )
Miércoles 29.02.2012 / 12:55
neta ajala y se apodere de todo el chapo guzman y mas aora con la gente nuevaa

zonerone ( e-mail: )
Miércoles 29.02.2012 / 12:03
pinches marranos de la linea y aztecas ya se loesta yevando su pinche madre andan todos culiados no saven ni pordonde le caemoss i les yenamos la caveza de puro plomo puro prm revolutcionn

ZETA ( e-mail: )
Martes 28.02.2012 / 19:58
aller me culiaron otra vez

.l. ( e-mail: )
Martes 28.02.2012 / 02:51
apuesto ke todo lo ke disen aki devereas es lo q miran en la tele brodis mejor ponganse a jalar x gente km ustedes mi juaritos esta devastadoo .l.

Martes 28.02.2012 / 02:48

XxXxCdS.Cdg.CpxXxX ( e-mail: )
Domingo 26.02.2012 / 19:46
Pora aqui i por china Cds oiganlo bien panochones asi quedemos todos regados en el piso melos llevo conmigo ipalos linieros y zetas b leyvas yano allan ni padonde correr los train arriados por todo mexico ni en sus casas los quieren yano caben en el infierno alla los volvere amatar putitos yake esta yeno el infierno de lineas y zetas.

( e-mail: )
Domingo 26.02.2012 / 17:43

PRM ( e-mail: BORRACHOS )
Domingo 26.02.2012 / 10:05

chapos GN ( e-mail: )
Domingo 26.02.2012 / 08:43
puras P... dicen los linieros disque linieros chaketeros manguerones luego ai los hubicamos i andan llorando como nenas cuando les trosamos el cuello con la sierra la voladora anda bolando putos ise clava en la garganta.

PRM ( e-mail: CDG )
Domingo 26.02.2012 / 06:36

( e-mail: )
Domingo 26.02.2012 / 06:35

( e-mail: )
Domingo 26.02.2012 / 05:34
vayase la V... de juarez pinches chaputos solo vinieron a cabar cn la paz de juarez

( e-mail: MYDREECK.COM )
Sábado 25.02.2012 / 01:39

tsadsfsdf ( e-mail: )
Viernes 24.02.2012 / 21:03
Los radios en sus frecuencias Claves especializadas La raza se encuentra al 100 Y mas esa de chihuahua Esa gente de la lineaaaaaaaaaaaaaaaaaaa No se raja para nada Mas vale que esten bien puestos No les traten de brincaaaaaaaaaaaaaaaar PUTOS LA LINIA YEGO PARA KEDARSEE EL KOKE

ZETA ( e-mail: )
Viernes 24.02.2012 / 09:12
alle rme culiaron por primera vez me gusto sentir la yuka en el culo.

( e-mail: )
Jueves 23.02.2012 / 19:42
pinshee jentte ignoranttte nttta que tiene que andar con esas M... como el P... de abajoo nttta pontte aser algo de probechoo pendejoo

linieroZZ ( e-mail: )
Jueves 23.02.2012 / 19:15
creian que no nos dimos cuenta P... que el chapo yego el lunes ala plaza si para eso tenemos los alcones i alos aztecas aki LA LINEA monta perros baja de la sierra o te bajamos a bazukasos TRAICIONERO as puesto atus compdres pon al mayo zambada ole tienes miedo porkeno lo mataste el dio la orden en culiacan dematar a edgar guzman atu hijo todo mundo save que el macho prieto el ondeado i los antrax lo mataron don arturo le hablo al mayo i el mayo dio la orden.

PRM ( e-mail: BORRACHOS )
Jueves 23.02.2012 / 08:51
PRM listos.

( e-mail: )
Jueves 23.02.2012 / 07:59
doblee a

( e-mail: )
Jueves 23.02.2012 / 07:52

PRM ( e-mail: BORRACHOS )
Jueves 23.02.2012 / 02:53

XxXxXxXxXXxXxXxXcds ( e-mail: )
Miércoles 22.02.2012 / 18:51
saludos pa los doblados AA i la prm ilos que esten apollando ala Gente nueva y alianza de sangre que andamos chambiando pa la CDS buscando la contra andamos sobre la ultima letra buscando el tope ya yego el chapo a chiwuas linieros ESCONDANSE TODOS

PRM ( e-mail: BORRACHOS )
Miércoles 22.02.2012 / 12:25

CDS xXxXx CPS ( e-mail: )
Miércoles 22.02.2012 / 11:34
un saludo para todo el cartel toda la compañia para la gente nueva los del comando x los de la barredora los antrax los 3 mandos i pa el patron de la tejana de lado y el chapito mas grande de la selula del CPS cartel de los pelones alos dela empresa que andan buscando el tope ala contra ya tenemos barios puntos ai en el sector awuas con la barredora cabrones

( e-mail: )
Domingo 19.02.2012 / 02:40

Domingo 19.02.2012 / 02:16

joaquin ( e-mail: )
Viernes 17.02.2012 / 09:24
chamakitos cagados siyo vengo de abajo muy abajo quien quiera tumbarme le cuesta la vida unos como vakas los mando levantar aqui estoi en juarez en mi plaza sigan corriendo yasaven ke aki estoi en la sierra de chiwuawua vengan abuscarme contras ala sierra tarahumaras aki estoi sembrando mis plantas y tomates regandolas y alludando al agente humilde no como los lacraZ ATTE EL CHAPO GUZMAN su peor miedo cabrones

( e-mail: )
Viernes 17.02.2012 / 02:08
ese dormillon, sleepy aqui esta tu gente del varrio chico trece, qvo homito pongase en contacto! aqui est el gato locote de los memorial park locotes!

Viernes 17.02.2012 / 01:38

( e-mail: )
Jueves 16.02.2012 / 05:59

UNIDAD ZETA ( e-mail: )
Jueves 16.02.2012 / 04:53
andamos buscando el tope en las ciudad de chiwuas ino le salen al tope esos chapos que los traemos con miedo. recibiran llamadas barios de aki contestenlas de lo contrario H... aron asu madre yo mismo les cortare la cabesa con la sierra. LOS ZETAS...

MYDREECK . ( e-mail: )
Miércoles 15.02.2012 / 23:18

( e-mail: )
Martes 14.02.2012 / 20:34
pura pinchi gentee puros carnale sputos somos INDIOS hijos de su perra madre el wero putos acabo de salir d ela torcida a vivir de neuvo la pinchi vida locos a tumbar pinchis chapetes a quien me ordenen C... traigo buena ranfla y el P... del dreck kiensabe kien evrgas sea junto con su pinchi marcos ke lo inicio no mame pinchi mocoso meco de la gente del samurai putos salidos desde el cherry templo azteca culeroos

( e-mail: )
Sábado 11.02.2012 / 14:38
jajaaaajajjajja AJAJJAAJAJJAJAJAJAJajajajajaj

PRM ( e-mail: BORRACHOS )
Viernes 10.02.2012 / 06:53
la PRM precente y ala orden para terminar con linieros y azcacas. puro PRM

Anonimus ( e-mail: )
Viernes 10.02.2012 / 03:42
DEA FBI cagense son vergassoi vera cheken el IP de joaquin i lada desde el merito badiraguato sinaloa itodabia miraran el satelite metan este numero en el foli 3 84357375 sin tan vergas caguense que el comentario de JOAQUIN es el mismisimo chapo guzman atte anonimus jack 6754./**

Anonimus Jacker ( e-mail: )
Viernes 10.02.2012 / 03:29
para enpesar para para todos vengo enpas linieros sinaloenses fbi i dea esta pagina tengo el (IP) de cada uno de el que escribe i veo que muchos son mangueras i otros son reales pero ai solo 2 que me iamaron mucho la atenccion qe me puse a investigar i son reales para JOAQUIN señor guzman estoi completamente seguro que es usted el que escribio esas palabras noce como dio a esta pagina o como supo de esto pero con todo el respeto usted es uno de mis idolos ino dire como supe todo de usted isupe que usted si era guzman loera pero espero que acave con esta gente llamdos Z i malandrines como los aztecas ate ANONIMUS DEA FBI saludos ni crean que noce que nos leen APOLLO AL CDS

la nueva clika ( e-mail: )
Jueves 09.02.2012 / 20:33
cual pinche barredora de sonora ke diske del cheko a ese P... ya lo mataron hace rato a y pa informar ke kedan doblados y panochos en los siguientes puntos info park aa-erendira aa-toronja roja y alrededores prm-horizontes aa-alrededores de c.u aa ay nomas pa ke se pongan trucha con estos P... ke no balen V... nomas ke para robar los putos aki seguimos fielez a los carnales mi gente

linea ( e-mail: )
Jueves 09.02.2012 / 19:56
ai muchachos nomas ablan por ablar jaja usted pendego del imperio callese la P... boca llo se como corre el agua en el juarez nuevo y en solidaridad. asi que usted sabe que nosotros isimo limpia ai jajaj todo los prm que andaban ai lla estan caidos jajajajja gracias al comando que usted lla sabe quen era el bueno jajaj y pues la verdad la linea tiene para todos asi que amarense los huebos y atorenle putos estasmo en el valle me ubico en guadalupe. la line esta en el mado jaja como les quedo el jale de sus pinchis municipales pendegos jajaj y aora bamos tras los de la policia unica los ministeriales sigen de nuestro lado como todo los soldado del sereso

moris ( e-mail: )
Jueves 09.02.2012 / 15:26
mira dreek tu eres un mil ranflas tu te ases para donde calientan gordas eso fue lo que dijo el erick que segun los guaraches que segun traes los compraste en unas segundas y tus plumas son de una gallima que desplumaron para el caldo del domingo entonses x lo siguiente agarra tus guraches tus plumas a y tu P... calendario tu quetzalcoath y todo lo que represente tu ranfla y metetelo x el C... pinche mocoso de M... pero eso es lo que dise el erick y el cholo de aqui de la ind 2 con copia para tu jente los sombis pinches tecatos de la altavista los ronosos del centro y a los piloteados que andan regados de parte del imperiote juarez nuevo el yonques

( e-mail: )
Jueves 09.02.2012 / 12:04
ese dreeck. pero si ya dijeron los aztecas que tu no eres nadie. que tu no reprecentas nada, que eres solo un pinche microbio. pues que pedo.

Jueves 09.02.2012 / 01:07

( e-mail: )
Miércoles 08.02.2012 / 17:40

galoyde ( e-mail: )
Miércoles 08.02.2012 / 16:07
un saludo para la wendy que no se vaña ni su aguelita norma de la colonia del carmen que es la ija de la lili y el banby

( e-mail: )
Miércoles 08.02.2012 / 16:03
un saludo para la peroda q se yama wendy

( e-mail: )
Miércoles 08.02.2012 / 16:00
un saludo para la rocio,joselyn,wendy de parte de el michel de la colonia del carmen

el melarosa ( e-mail: )
Miércoles 08.02.2012 / 00:52

PRM ( e-mail: BORRACHOS )
Martes 07.02.2012 / 13:34

LEYZAOLAAC ( e-mail: )
Martes 07.02.2012 / 08:41

joaquin ( e-mail: )
Lunes 06.02.2012 / 21:39
a chamakitos cagados entiendanlo bien plebes primero tumbo ala linea yo solo a aque me quiten mi bello sinaloa cuantos son tomen nota lineas zetas beltran leyva y aun asi los traigo arriados i selos dire i selos digo ami me pelan la V... no ocupo gafes ni linea ni lacras ni al gobierno aganme frente aki estoi en juarez chamakitos cagados ATTE CHAPO GUZMAN su pesadilla pollos.

la linea ( e-mail: )
Lunes 06.02.2012 / 18:22
aki la linea al millon putos ya saven kuleros ke con nosotros no pueden pinches pànochos y dobladas H... uen a su P... V... bomaba madre la linea sigue al mil ya cayo el flako el marrufo y ahora andan tras el chapo mejor metanse un plomaso ustedes mismos porke donde los agarremos los vamos a empinar putos aki pura ___________ kuleritos gente d delicias FIELES A LA DE LOS SEÑORES

Lunes 06.02.2012 / 17:01

FLAMAS ( e-mail: )
Lunes 06.02.2012 / 15:35

mydreeck.CdJ ( e-mail: para ESE PUTO )
Lunes 06.02.2012 / 15:19

PM ( e-mail: )
Lunes 06.02.2012 / 04:38

( e-mail: )
Domingo 05.02.2012 / 20:36
miren hijos de su perra madre ya estuvo beuno que esten cagando la linea sigue bien firme todo estados unidos es de nosotros hasta ahi vamos bien mir apinchi dreck P... qu ete dices ser linea no estes poniendo P... por que despues les damos suelo y andan llorando las familias soy indio putoss aztecota a morir ndo enranfladote y si fueras azteca pinchi dreck deberias saber ke no se puede andar diciendo si eres indio stas pendjeo y pones otra P... sureños y aztecas controlando no mames pinchi mocoso los sureños no son gente esos weyes se entraron hace poco si no sabe no hable no est ecagando la verg apinchi mocoso pendejo

LINEA ( e-mail: )
Domingo 05.02.2012 / 18:42
jaja lla callense pinchis niños abladore.los prm no balen para pura made ok.y juares sige firme y todo es gracias a nostros la LINEA.jente de respeto pinchis rancheros como frigoles ban a la baga cunado quieran aqui los espero en el valle.y usted ni sinaloa a de conoser y lla anda defendiendo un tereno que ni de ustes ed jaja pinchis muertos de ambre la linea segimos en el jale visente carrillo fuentes

PRM ( e-mail: BORRACHOS )
Domingo 05.02.2012 / 05:13

Kaerrez creew 2006 Pachuca! ( e-mail: )
Sábado 04.02.2012 / 18:10
mejor rifeen vanda en lugar d pelear tsss...!!.q viva el graaf.. Mexicano!"awev..

Sábado 04.02.2012 / 17:43

CDG ( e-mail: PRM )
Sábado 04.02.2012 / 16:03

( e-mail: )
Sábado 04.02.2012 / 15:36

Viernes 03.02.2012 / 18:58

LINEA ( e-mail: )
Viernes 03.02.2012 / 14:36
JAJAJAJAJAJAJA aqui estamos el 17 atte la linea

CDS X x X x X ( e-mail: )
Viernes 03.02.2012 / 00:13
gente nueva ya resivimos la alerta del señor guzman la orden se cumplira nomas para decirles alos LINIEROS que son culos i venimos desde sonora i mexicali arreforsar la plaza poes aka tambien corre biento putos zetas i lineas lacras muertos de hambres muy pronto les iegamos alos H... asos atte el barredora de sonora i el compa checo 6 de mexicali agarrense putos....

la linea ( e-mail: )
Jueves 02.02.2012 / 20:55
segimos en el mando chapulines ban a la baja atte la line de el pueblo de cd juarez jente del17 y 25z

CDG ( e-mail: PRM )
Jueves 02.02.2012 / 06:57

linea ( e-mail: )
Miércoles 01.02.2012 / 21:03
usted mijo no se preocupe por eso. llo le aseguro que todo regresara a la normalidad por eso estamos luchando y los bende narangas ban a la baja.y esta cd sera la misma y patas cortas. cuidense que segimos trabajando. atte la linea

el pitudo ( e-mail: )
Miércoles 01.02.2012 / 20:31
aqui en juarez todo estaba muy bien hasta que llegaron los pinches enanos C... del chapo aqui en la ciudad habia dinero para todos sin secuestros extorciones ni carjakers pero por querer quedarse con todo el pastel todos andamos pa la berga gracias pinche gente nueva digo gente muerta por venir a cagar el palo a la ciudad todo estaba bien cuando rifaba la linea no digo que este a favor pero quiero que juarez sea el de antes

( e-mail: )
Martes 31.01.2012 / 17:24
enderesando jente! atte la liena recta en cd juarez! NUEVO CARTEL JUAREZ CHIHUAHUA

Martes 31.01.2012 / 09:46

linea ( e-mail: )
Lunes 30.01.2012 / 19:06
animo los de abajo pues ustedes puro blablabla- aqui los esperasmos atte. la linea---------------------------------------------------------------------------

PRM ( e-mail: CDG )
Lunes 30.01.2012 / 17:18

clavo ( e-mail: )
Lunes 30.01.2012 / 14:30
saludos y respetos carnaleste P... se cre blindado pero guache carnal a estos putos si no los matamos nosotros se matan entre ellos lla estos putos se apendejaron y le soltaron las llaves a las trensudas y los isieron de agua aora las trensudas andan asiendo segun ellos el nuevo cartel de juarez pero es lo que queda de estos putos que lla se torcieron se los dije a los putos linieros los putos aztecas nadamas los iban a usar de gancho para meterse a juarez con una bandera de aqui para aser P... a la jente con esa bandera pero todos sabemos que los aztecas son puros gabachos , chicanos, y uno que otro vende patrias que les sigue el rollo pero esta istoria es vieja primero estan matando linieros para comerles el pastel a pero gracias x el jale nos aorran andar tirando basura pero todos sabemos que despues se ban andar matando entre ellos mire las M... con las que quieren enconchar a juarez matando policias pero aora si se la ban a pelar x porque nuevo o viejo cartel de juarez nos p

PRM ( e-mail: CDG )
Lunes 30.01.2012 / 08:10

linea ( e-mail: )
Domingo 29.01.2012 / 21:18
mire mijo el que se debe de bajar de su nuve es usted.como cres que bas acabar con mi jente lla jaja yo soi linea y estoi directote. tu as de ser un asalariado. usted y su jente deben de saber que la linea no se acabara. nuca oquei. y eso que estamos aciendo con los municipales es por que se rompieron, y leisaola se tiene que ir y asta que el no se retire su jente segira callendo, y pues si ustedes dicen que no dañana a la jente sivil. porfabor ai les encargo que dejen de secuestrar.extorcionar,y andar de carrsjakins. y pues sabemos que leisaola no es nu de aqui ni de alla.pero eso si siga agarando de mi jente y si jente ba a segir callendo asi mismo contrarios andense con cuidado que lla ai unos sectores que tenemos ubicados. que se ba a trabajar en esos puntos. lo unico que les puedo adelantar es que se cuiden esos de villa colonial y la linea estamos firmes. y al serbiso de la jente. lealtad al CDJ CHIHUAHUA.

clavo ( e-mail: )
Domingo 29.01.2012 / 16:33

Viernes 27.01.2012 / 20:56
Leyzaola. Si sigues apoyando a EL CHAPO Y los montaperros y agarrando pura gente de nosotros te vamos a estar tumbando un elemento diario para q sepa toda la ciudadanía lo corrupto que eres. Leyzaola=Delincuente con placas. ATTE. NCJ

( e-mail: )
Jueves 26.01.2012 / 13:14

josemaria ( e-mail: )
Domingo 22.01.2012 / 02:12
VENIAMOS TAN BIENNNNNNN ¿Peroooo por que mierdaaa tuvieron que surgir Esta Mugree De lOS WACHInosecuatoooo????? Queee lo parioooooo....

PRM ( e-mail: CDG )
Sábado 21.01.2012 / 17:37

( e-mail: )
Viernes 20.01.2012 / 02:21
No mames pinche lambe guevos lo de la's cuotas todos sabemos que es Rollo de los aztecas siempre an traido ese pinched jape papa Gerhard de tumbar a low paaisas x esoteric low laquearon en el chuck low laqueqron low paisas p"rm 'y low de la.linea puss son chapetes tienen que agarrar a estos tecatos para usarlos como Carney de canon peri de todos no se baseness 1 cada 1 del pemmican vale x 10 de ustedes x esoteric les quitamos la mitad del cereso adora la.mitad de Juarez y pronto todo x sue putas marranadas s e respite la historia

( e-mail: )
Jueves 19.01.2012 / 12:47
linea!! mijo echele muchas ganas. poues tu as de ser el que anda cobrando cuotas de a tosoton. y jalesitos de 20. jajaa andas mal morro pendego. io no ando aciendo jalesito yo tengo jente que trabaja para mi. yo no ando con H... aderas.digame cual es su ubicasion no sea culo. io me encuentro en el valle y sausal. y mi dreck. echele putasos a los contras de mirda que me dan verguensa. aora toca que caiga su jefe m1oo. aqui segimso.cartel cd,juarez ccd. la linea..

PRM ( e-mail: CDG )
Miércoles 18.01.2012 / 07:20

Dreeck de la col.Independencia ( e-mail: Al millón con LA GENTE AZTECAS )
Miércoles 18.01.2012 / 06:52

linea ( e-mail: )
Martes 17.01.2012 / 22:28
mire mijo se lo boi a degar bien claro. porfabor ia no este ablando por ablar por que dise puras penegadas. la linea es recta i mui larga asi que no me benga con sus H... aderas. que aqui en juares ustedes bien sane que nuca an sido nada ni nca lo seran.siempre an sido la basura de juarez(skoria) aqui en juares quienes an mantenido tod somo nostros.linea.linces.aztecas. asi que no mebengas con tus mamadas. mejor lla bette con tu patron a ordeñar bacas que es lo unico que saben aser. atte. la LINEA.catrel de JUAREZ. mi r8..lo apollo en lo en todo ando en el valle trabajando.para lo que se ofresca...a y por fabor ya no maten inocentes..

Martes 17.01.2012 / 09:41

( e-mail: )
Martes 17.01.2012 / 02:54

PRM ( e-mail: BORRACHOS )
Lunes 16.01.2012 / 17:52

( e-mail: )
Lunes 16.01.2012 / 10:56

( e-mail: )
Lunes 16.01.2012 / 07:20

Lunes 16.01.2012 / 07:13

( e-mail: )
Domingo 15.01.2012 / 07:47

PRM ( e-mail: BORRACHOS )
Sábado 14.01.2012 / 12:59
Q pues homeboy, gusto en saludarte y saver q estas bien. yo corro PRM y estoy asus ordenes.

( e-mail: )
Viernes 13.01.2012 / 14:41
Saludos al shismosito

QUINTERO ( e-mail: )
Jueves 12.01.2012 / 19:41
Hey un saludo para todos los borachos estuve en Beaumont Tx. alla no habia raza, puros cincos. y la corrian los ochos. solo estaba un carnal q le dicen el Bulis... conocido alli como Borracho. yo me juntaba con el por q les agarre cora. su padrino de el creo es Acuña no estoy bn seguro lo levanto en Huntsville. yo pase por huntville cuando iba d salida pero solo estuve la tarde alli. en la noche me aventaron pa migracion. ya en las paredes me tope con mas raza. El cocho de alli de austin, el michoacano y otros 2. alli me dejaron unas directas. a mi me dicen el chilango. ahorita estoy en el df. Ahorita estoy al tanto de el Bulis q ya esta en Huntsville. Yo soy d alla de Austin. Y traigo cora. ya me quiero aventar para atras haber si la armo. Un saludo con todo respeto.

JARUDO LOKOS ( e-mail: )
Jueves 12.01.2012 / 04:48

Miércoles 11.01.2012 / 02:55

scop ( e-mail: )
Martes 10.01.2012 / 21:35
no mamen uno sale del cereso y de lo que se entera que jarudo y pelones se unen acg-msf ya no estan unidos con los hea que los msh andan solos y que acaban de salir unos pinches barrios cagados que son los fl-trl-bae pinchis bola de fresas fracasados y los 5ta no valen V... igual que los swk de la melchor bola de P... puro aa putos

( e-mail: )
Martes 10.01.2012 / 17:25
Simon. Àl 100 con el chapo

( e-mail: )
Martes 10.01.2012 / 15:09
jajaja q bueno rolyo train 2a estan bien cagados! sigan en su rollo de extorcionadores. carjacken.y secuestradores..siga le labiendole los pies al los patas cortas! jajaja sigen callendo changos. la linea esta fimre y recta atte 17 en el valle caiganele

( e-mail: )
Martes 10.01.2012 / 09:20

( e-mail: )
Lunes 09.01.2012 / 15:28
No mames pinche maquilero seme Ase que eres un punetero que no sabes ni que pedo al unico que as matado es al maricon que ves en el espejo ya maton . Sal del closet tu si eres de Juarez mi juanga y arriba juarez

( e-mail: )
Domingo 08.01.2012 / 13:49
k se pudran la jente del chapo yo nasi aki en juarez i aki muero trabajo para la linia i kada bes k mato uno de esos muertos de hambre me da tanto gusto akabar con eyoos dygamen donde esta esa jente ya no se esconda mas ay bamos la linia remgando jente del gato ai andamosss chidota bjl

000000000000000000 ( e-mail: )
Domingo 08.01.2012 / 13:34
---------------los cochados---------

( e-mail: #1 )
Domingo 08.01.2012 / 04:27

PRM ( e-mail: CDG )
Viernes 06.01.2012 / 15:50

colega ( e-mail: )
Viernes 06.01.2012 / 12:48
H... uen a su madre los de la line y los chicanos y tu broda mejor busca pajinas de dios no que lla te reabilitaste P... arrepentido a y a tu puma metetelo x el C... jajaj

para el PRM ( e-mail: )
Viernes 06.01.2012 / 03:47
mira dikse ke tu mucha prm ike aka traes puro bla bla bla mejor sierra el osiko por ke aki en juarez M... como tu es la ke esta acavando kn la imagen de mi ciudad los ke nacimos aki seamos chiknos mexicanos ati ke te valga madre somos de JUARITOS CITY y io camelle pa el chuma de villa ahumada y grasias a dios me sali y conoci A JUESUCRISTO Y EL ME ESTA SALVANDO DE TODO y ya major no sigan ablando y aserkense a la iglesia es lo mejors tss no kise desir groserias

linea ( e-mail: )
Jueves 05.01.2012 / 18:13
ustedes puro bla bla bla. sin palabras aqui los esperamos atte la LINEA.

Jueves 05.01.2012 / 15:22
Claro q no eres sicario, para eso t falta......muuuuchoooo. eres un simple P... extorcionador q solo gana pa medio tragar al igual q toda tu gente.cobrando ala gente humilde quitandoles lo poco q ganan en ves d darles pa q c alibianen c los quitan ustedes x eso siempre an sido y seran unas pinches mierdas mendigos poquiteros. ya no H... uen ala gente... mejor alibianenla.

lineros ( e-mail: )
Martes 03.01.2012 / 18:23
linea yo no soi sikario pero cuando ai que trabajar trabajamos. io muebo el negocio creo que me entiendes. tengo jente q trabaja en eso de matar mierdas enanos y usted compa pues dise que fue trabajador. entonces trabajabas para la linea. y si quiere jalar ai estoi io para dale jale. ando io en la area de el valle. soi jente de alto rango. el L17 sigo chambiadno

( e-mail: )
Martes 03.01.2012 / 10:23
netha weyes me pongo a leer todas su P... y me dan risa NETHA SON UNOS IJOS DE MAMY KE NO SALEN DE SU CASA POR ESTAR EN LA COMPUTADORA JAJAJAJAJAJAJA mejor ablen de pandiyas lokos los AA pa empesar es una pandiya estupida ke el chaputo les da feria pa ke kebran aztekas y diske les va a dar la plaza de juarez los aztekas pues tabn es una pandiya ke la mando ala gavesh la linea por ke no supo controlas la plaza OSEA WEYES LA LABIA KE USTEDES TIRAN AKI ES LA KE SALE EN LA TELE O EN EL BLOG DE LA NARCO UN VERDADERO SIKARIO NI TIEMPO TIENE PA ENTRAR A ESTAR MERMAS NETHA NO digo ke io sea pro era encargado de un punto ase 3 aaños y eos si eran tiempos buenos todos trabajabamos :) ya chavos ballan aver si ya cago el chapo o el r8 JAJAJAJAJAJA

PRM ( e-mail: BORRACHOS )
Martes 03.01.2012 / 07:29

( e-mail: )
Martes 03.01.2012 / 06:35

bower ( e-mail: )
Martes 03.01.2012 / 05:57
ke kabrones ke asiendo hijos de mami mejor ponganse a rajar kabrones arrez putoz

tibu ( e-mail: )
Lunes 02.01.2012 / 12:57
k tranza hijos de perra aka nadamos bien resio esto es un aviso para todos los de la LINEA se los va cargar la V... putos ya se la saven k los DOBLE A son los k van a controlar la plaza jajaja cuidense todos putos chavalas

manuel alfredo ( e-mail: adrianass )
Lunes 02.01.2012 / 07:35
bayansen alaberga pinchis narkiyos culos nomas tiran su flou putos ino balen berga putos

bebe ( e-mail: )
Lunes 02.01.2012 / 07:25
H... en a toda su P... madre de M... kuleros toda la bola de pendejos

( e-mail: )
Sábado 31.12.2011 / 14:45
a pero como son abladore BLA BLA BLA aqui estamos en el valle.los esperamos con gusto.y sigan con su mil amores. jaj ec batito no era nadie jaja aqui rifa el gatto.y los escajeda atte la linea.fuentes

virus ( e-mail: )
Viernes 30.12.2011 / 19:10

barredora CXDXS ( e-mail: )
Jueves 29.12.2011 / 17:37
un saludo atodo los chavalones que andan chambiando ino basilando yasela saven cabrones que con el CDS asta la muerte asi quedemos todos en el piso agonisando i para los linieros que no le sale al toro ni alos topes que andan buscando auien secuestrar o chikotiados de un lado a otro yatenemos barias casa de seguridad hubicadas poes somos gente nueva ino malandrines muertos de hambre ATTE LA BARREDORA DE SONORA

Jueves 29.12.2011 / 13:54

clavo ( e-mail: )
Jueves 29.12.2011 / 13:07
miren la jente de zaragoza lla nos enteramos que los de la linea y los aztecas les estan cobrando cuotas y les estan quemando los cantones pero es importante que se pan que esta jente los aztecas y la linea trae la verde x parte de todos los clanes lla van de caida no se dejen y presenten pelea estos son puros chicanos drogadisctos que se quieren aprobechar de la jente de cd juarez pero acuerdsense lo que dijo el general zapata es mejor morir de pie que vivir una vida arodillados y dijo mi jeneral villa matelonlos despues investigamos pero el respeto se gana y los clanes tambien nesesitan ver que ustedes le ban a salir x lo suyo pero aora estamos para apollarlos y estamos con ustedes atte prm y los clanes

clavo ( e-mail: )
Jueves 29.12.2011 / 04:35
saludos a los carnales los borrachos seguimmos al 100 gracias a los chavos que empinaron al mil amores 4 menos lla estos batos estan mas torcidos que nada lla son las perillas de juarez si no les pegan x un lado les dan x otro aqui andamos en juaritos y en chihuas y ando de lo mas feliz x esos chicanos de M... que se la pasan H... ando a la jente de juaritos con sus pinches cuatas no saben camellar x eso tumban a los comerciantes pero lla se les callo el circo y lla nadie los apoolla ponganse las pilas carnales aleonen y caminen derecho para seguir representando al mescal como debe de ser jale es jale pero las cochinadas no son buenas a camellr atte:prm

( e-mail: )
Martes 27.12.2011 / 11:40
mire morro esa clave de radio no existe. usted megor que nadie sabe.pero gracias lle me dieron el informe y ustedes no son ni de aqui ni de alla .andan solos y esos welles son chapulines y son los primeros que se ban.a no est de ablador aqui andamos pedaso demierda. pinchis 35.muertos de ambre. lla se les cargo la V... con la jentte del 17. leales al gato. atte la linea.

( e-mail: )
Martes 27.12.2011 / 06:52

( e-mail: )
Lunes 26.12.2011 / 19:46
asi que andan trabajado de roba carros orale chavos gracias x la informacion. llegaremo a rebentar esos puntos.o ablen antes de que sea tarde para quien jalan? aqui jent del 17,la linea

el sleepy vct ( e-mail: 13 )
Lunes 26.12.2011 / 18:22
esos putos de la hueco st son culos aki stamos n corto salganle chavalas puro memorial parke locos vchico 3sote .vct los ace M... norteños de caca

DE SU PATRON ( e-mail: mensaje dirigido a la fmc )
Lunes 26.12.2011 / 13:39

( e-mail: )
Domingo 25.12.2011 / 17:25
estos welles q train jajaj sigan de aBLADORES purobla bla bla. aqui los esperamis la LINEA sin comentarios. CDCJ.CHIHUAHUA

( e-mail: )
Domingo 25.12.2011 / 07:30
fama one putos de hps xv cd juaritos killer

( e-mail: )
Domingo 25.12.2011 / 07:26
ke transa P... aki el teers y el fama de la ept

Sábado 24.12.2011 / 17:51

Sábado 24.12.2011 / 17:46

( e-mail: )
Viernes 23.12.2011 / 07:23
llat dige estoi en guadalupe.con los esajeda. cuando quieren llegar aqui los esperamos bola de pendebos abladores.muertos de linea .gobierno es nuestro. ganado el combate no bagan sus cuernos todos bien atentos por si ai qgalarle los uniformados escuchan disparos megor no se enredan saben que la plaza sige cutodiadapor LOS LINSES

clavo ( e-mail: )
Viernes 23.12.2011 / 04:50

( e-mail: )
Jueves 22.12.2011 / 14:50
aqui segimos chambiando con gusto.llegen al valle aora esa area es mi sucursal.para q se ubiken estoi en guadalupe.el L10.con el 17.GENTE D RESPETO chihuahua.CD.JUARES .LA LINEEAA.AZTEKAS.LOS F.UNION LOS Z´BELTRANES LEIVA.AI NOS ANDAMOS EN EL JALE__________

PRM ( e-mail: BORRACHOS )
Jueves 22.12.2011 / 02:51

linces ( e-mail: )
Miércoles 21.12.2011 / 21:26
soi soldado lince andamos en el grangero trabajando. yoy mi comando les trabajamos en el arria de las torres.tumbando esclabos.chaparros.soi jent del biera comome encanta ver correr al enemigo.alcansarlo y matarrlo con mi 9 bereta o con pantion ai que mandarlos.sigan apollando al gn.y asi mismo segiran callendo atte,CDCJ.CHIHUAHUA.un saludito al comandante gatto..gobierrno chambiando guntos---------------------------------------------------------------------------------------------------

boxer ( e-mail: )
Miércoles 21.12.2011 / 19:46
mire pinche mocoso cholo no ande con sus M... yo soy de chihuahua capital P... ya te tengo ubicado a ti y a tus compas si quieres jalar ya no pongas tus M... aqui wey yo te buscare entrando el año

roger ( e-mail: )
Miércoles 21.12.2011 / 15:41
mira piche liniero de M... usted y sus pinches linces no controlan ni V... ustedes no sirven nadamas que para fertilizar tierra y si mucho mama a al culon de amado carrillo al rato lo mandamos a alla con el mejor no ande de osicon P... y amarrense los guevos y no anden con tanta M... de mantas x que lla se pasaron de peines pinche bola de culones y aqui andamos en todo nuetro juaritos x que nosotros de aui somos pinches chicanos de M... puro mexiclotes pinche cochado y saludos a todos los clanes aa bb prm blindados gn hay que seguirle poniedo la muetra a estos putitos pa que se les quite lo chavalonas a qui andamos patrullando la galeana

PRM ( e-mail: MEXICLES )
Miércoles 21.12.2011 / 06:14

( e-mail: )
Lunes 19.12.2011 / 17:28
la linea segimos en el linea esta recta.linces.comando armado protejidos por el gobierno.y por nuestro pawer.ban a la baja los enanos.bola d pendegos.y si no kieren crer chequen el mapa.estado de chihuahua.fiel a el SR.AMADO CARRILLO linea________________________________________________________________________________________________________ nuca terminara

draw ( e-mail: MSF CUESTA LOKOS RIFA )
Lunes 19.12.2011 / 14:38
jaja calmate ´pinche boxer k me la pelas se mas k tu pelada wey pelada de todolo ktu quieras wey i si quiero jale para ganar una M... como tu P... q trabajas en maquilon pura V... jarocho estaras epndejo wey soi del paso tx wey coza k nunca seras tu de aya puedo movermerca de aqui dejaurez al paso tx cuando yo quiera tengo mas huevoz k tu wey pelada asi te lo digo P... quiero jale ya sea en laliea o donde sea neta dejense cai ala cuesta

PRM ( e-mail: BORRACHOS )
Lunes 19.12.2011 / 09:34

lineros ( e-mail: )
Domingo 18.12.2011 / 18:57
la linea esta bien marcada asi ke no la traten de brincar jaja los prm lla murieros .mas bien nuca exisitieros pobres loncheros mediocres.segimos mobiendonos en nustras lineas quieren jale ai estamos jente del 17 en el granjero

BORRACHO CDG ( e-mail: )
Viernes 16.12.2011 / 16:40

linerotes ( e-mail: )
Viernes 16.12.2011 / 15:58
pues la linea aqui segimos mas firmes que nuca carrtel de cd juares la linea, jent del jl y de los escajeda en el valle segimos rifando la linea

el perro ( e-mail: )
Jueves 15.12.2011 / 19:55
mira pinche draw cagado vas y H... as a tu madre culerito hijo de la V... eres un pinche mocoso cagado no vales V... si quieres jalar metete al maquilon que eso te queda muy bien pinche jarocho porque pa sicario te falta mucho cuando ves a la munucipal te surras que sera si te disparan otros cabrones soy el boxer de la_____

carla ( e-mail: )
Miércoles 14.12.2011 / 13:27
te amo raul de parte de carla

PRM Y CDG ( e-mail: )
Lunes 12.12.2011 / 03:45

( e-mail: )
Sábado 10.12.2011 / 09:38

shagyOneR ( e-mail: )
Viernes 09.12.2011 / 15:29
k transa k transdas mis chavos barrio doble u efe uno de tierra nueva cocha jajajajajaja b*wf1

( e-mail: )
Jueves 08.12.2011 / 13:30
theeeDoooBleee A viiiveee

netzarel ( e-mail: )
Martes 06.12.2011 / 13:19
la federacion manda matar o morir

kyfesillo0 ( e-mail: becede )
Lunes 05.12.2011 / 07:42
pinche bola de P... los jarudo y los de el 7 son re culos puro pinche msh bcd culeroos pinche bola de muertos de ambre no saven ni madre de la kalle y ya se kreen bn vergass P... puro meeseehere lokos diiecisiiete

EL DRAW DE LA MSF ( e-mail: )
Sábado 03.12.2011 / 10:37
quien sea pero quiero jale carnal vivo aqui atras del smar la cuesta mi roguer bajando la bajadita de atras del smar la cuesta enfrente de la papeleria en la cuadra k esta enfrente de la papeleria aii me junto o en el parque k esta enseguida del super six diganme si o no para jalar con alguien mas no me importa si me kebran o no simpre me la e rifado awevo

( e-mail: )
Viernes 02.12.2011 / 08:27

roger ( e-mail: )
Jueves 01.12.2011 / 14:54
mira llo te recomiendo el cartel se sinaloa rllos pagan bien y te ensenan todo sobre el negocio desde lo basico asta logistica los de la line estan contratando mucha jente pero es porque se las matan muy rapido unete al que tu quieras nadamas amrrate los guevos y acuerdate de la ley del oro si quieres llegar lejos en ete negocio a y de pasada que H... uen a su madre los linieros que quedan y sus lambe guevoz las trensudas ay les mandamos mas guaraches apestosos x que a los indios que los traian los pusimos a comer cal

sdfghj ( e-mail: )
Jueves 01.12.2011 / 10:37
tragen V... putitas )

LRT !!CREWS ( e-mail: )
Jueves 01.12.2011 / 07:22

Miércoles 30.11.2011 / 12:39

EL DRAW DE LA MSF ( e-mail: )
Miércoles 30.11.2011 / 11:38
si tuvieras power neta wey ya uvieras caido si quiseras mas jente netha pero creo k es puro rolo el tuyo

estiben ( e-mail: )
Miércoles 30.11.2011 / 11:31
si eres un entrado amarrate por q aii refuego con migo si bienes por la paz o se arma ese jale arres vamonoz pa arriva k este al 100 simon

estiben ( e-mail: )
Miércoles 30.11.2011 / 11:25
solo vengan voi andar con una zudadera de cuadros asi grande con una gorra y un goorro de la sudadera preguntale ala bola q ande aii por el draw o el estiben diganle k no es nada grave solo para k den informacion nunca e trabajado para nadien i aora solo quiero levantarme salir del ollo en el k me encuentro

( e-mail: )
Miércoles 30.11.2011 / 08:05
si c puede, todo es posible. pero como c llama la pandilla o el grupo q t respalda?? a q cartel conoces???

estiben ( e-mail: )
Lunes 28.11.2011 / 07:18
vivo aki atraz del smart la cuesta aii unos condominios pero vabajan la bajadita pasan los segundos edificios de los condominios acavandose aii una papeleria enfrente de eza papeleria me junto haora nadare aiii no tengo dinero para llamarles o ir con ustedes pero soy mui efectivo creci en el barrio desde los 6 años i sigo en el con mucha jente alado mio respaldandome y ya quiero empezar si se puede desde hoy como ven

( e-mail: )
Lunes 28.11.2011 / 06:34
si hay jale y feria tambien. dime d donde eres y si has andado en pandillas. y cuando quieres empesar. yo t mandare una direccion y numero d telefono.

estiben ( e-mail: )
Domingo 27.11.2011 / 12:05
alguien k me pueda dar jale en la mafia o donde sea en cualquier parte k sea quiero irme riquis no les fachare para ni madre neta contestenme si tienen neta

( e-mail: )
Sábado 26.11.2011 / 13:50
banda los escuby

SEROK ( e-mail: )
Viernes 25.11.2011 / 19:56

xl feat big ben ( e-mail: )
Viernes 25.11.2011 / 19:40

virrey ( e-mail: )
Miércoles 23.11.2011 / 15:14
fmc. el calset. uno

( e-mail: )
Viernes 18.11.2011 / 15:57
el barrio wfzotez controla by nefek monki kere y vallanse a la V... los entrados y si no le gusta H... e toda su P... madre

( e-mail: )
Jueves 17.11.2011 / 08:05

dormilon ,el sleepy ( e-mail: )
Miércoles 16.11.2011 / 21:25
sur up ese lokotes del chico trece del paso.tambien a todos los aztecas dandole al cien en juaritos ......

dormilon ( e-mail: )
Miércoles 16.11.2011 / 21:19
la V... putos northsiders lame wevos me lan pelado since god knows when puro varrio chico 13 memorial parke locotes .norte18 no traen nada son chapetes puñales del cereso todos savemos eso.ha ha

ivan ( e-mail: )
Lunes 14.11.2011 / 15:51
te amo kititos x siempre puro amor mamita .

( e-mail: )
Miércoles 09.11.2011 / 17:17

EL DEADER ( e-mail: el deader locochon )
Sábado 05.11.2011 / 08:02

fmc ( e-mail: CAMP. VIRREYES )
Lunes 24.10.2011 / 13:52

tHe pinshe geNT ( e-mail: )
Viernes 21.10.2011 / 18:15

( e-mail: )
Viernes 21.10.2011 / 06:53
el imperiote diez desde juarez nuevo 656 putos pa que aprendan y no anden de chavalas

( e-mail: )
Jueves 20.10.2011 / 08:41

( e-mail: )
Jueves 20.10.2011 / 08:37
jarudo locos :D ALGO MAS QuE BARRIO

( e-mail: )
Jueves 20.10.2011 / 04:53
barrio imperio 10 rifa putos desde juarez nuevo

BJL ( e-mail: )
Lunes 17.10.2011 / 21:15

juaritoz ( e-mail: )
Martes 11.10.2011 / 08:42
y tu das lastima de ver la poca educasion q tienes,lavate el osico con clorox para q t quede limpio.demuestra lo que pareces no lo que realmente eres UN PERFECTO IDIOTA. vive y deja vivir a los demas, todos tenemos derecho a vivir como nos plasca NO COMO A TI TE GUSTE. el muro es libre y para todos. A ESTE STUPIDO NO LE HAGAN CASO ESTA FALTO D CARIÑO, COMO NADIE LO TOMA EN CUENTA. animooooooo gente a scribir,,,,,,.

te cocha ( e-mail: )
Lunes 10.10.2011 / 18:27
H... en a su P... madre C... tiran de amadre M... P... si muy sicarios no andubieran escribiendo M... y media muy aztecas,mexicle,aa vayanse ala V... mierdas y dise muro del grafity no del sicario bola de P... y el hijo de su P... madre k dise k jarudo me cayo en la punta de la V... el M... aber si cuando nos topemos ba a segir tirando tanto rollo y ba pa todos los diske sicario nacos pinches P... dan risa jajaja casi me meo de la risa leyendo sus pendejadas

jarudote ( e-mail: jarudote )
Sábado 01.10.2011 / 12:19
tambien recordando a los grandes ,el pancho,el toto,el gordo lokotes del jarudo

Viernes 30.09.2011 / 11:51

2aa ( e-mail: 2aa )
Viernes 30.09.2011 / 05:51
cuerno y pechera para cuidarme y destrosar cumplo la orden del jefe torturo y mato 2aa

clavo ( e-mail: )
Martes 27.09.2011 / 13:41
mira pinche liandro este es un estado mexicle y tu y lo que queda de tu P... organizacion nos pelan la V... aora ya esta frontera pertenese a la nueva linea osea al cartel de sinaloa y no digas que los sinaloas te la pelan dile eso al perro de tu jefe vicente el chapo controla y controlara x siempre marrana hay esta tu respueta alos muertos de sinaloa mira quienes estan callendo siganle jugando al V... y sigan poniendose de apechito puro prm P... y puro juaritos lla ballan a esconderse al chuco de donde salieron pinche chicano de M... y aqui estamos y estaremos x simpre prm aa blindados jente nueva dorados bb paisas y todos los clanes 100 x siempre mexicanos

( e-mail: )
Jueves 22.09.2011 / 14:47

ivan ( e-mail: )
Miércoles 21.09.2011 / 09:16
te amo kititos

omar ( e-mail: )
Martes 20.09.2011 / 13:25

( e-mail: )
Martes 20.09.2011 / 07:11

PRM ( e-mail: BORRACHOS )
Lunes 19.09.2011 / 03:57

sleepie ( e-mail: )
Domingo 18.09.2011 / 21:41
saludos a la gente azzteca. del varrio chico trece del chuco vct q-vo

( e-mail: )
Viernes 16.09.2011 / 07:58
fMC es uno de las clicas que hizcieron historia en juarez.

virrreyes´CAMPESTRE ( e-mail: fMC )
Jueves 15.09.2011 / 19:41

BORRACHO ( e-mail: PRM )
Jueves 15.09.2011 / 19:15

Miércoles 14.09.2011 / 13:41

( e-mail: )
Miércoles 14.09.2011 / 08:27

( e-mail: )
Lunes 12.09.2011 / 15:11

braulio ( e-mail: )
Lunes 12.09.2011 / 04:22
el fanekerone kiere un juarez en paz

bmx juarez ( e-mail: )
Jueves 08.09.2011 / 10:44
jovenes baikiando por calles

losny and trane ( e-mail: )
Jueves 08.09.2011 / 10:40
el losny y el trane kontrolando putos jajajajaja

by shagy ( e-mail: doble u efe uno )
Sábado 03.09.2011 / 05:55
k trampa k tampa mis chavos barrio wf1 detierra new cocha

juarez ( e-mail: )
Jueves 01.09.2011 / 15:26
putos que viva la vida loca

( e-mail: )
Jueves 01.09.2011 / 12:12

xhelazz ( e-mail: )
Jueves 01.09.2011 / 06:43
ia pinshez paiasos paresen viejas de mercado pongans a jalar pinshes traga deokis

jarudo lokos ( e-mail: bjl )
Martes 30.08.2011 / 11:27
jajaj sieteros abaladores !puro bla bla bala pues cuadno kieran aqii stamos firmes con el pawer de seimpre atte, jarudo lokotes

( e-mail: )
Lunes 29.08.2011 / 14:35

monica ( e-mail: )
Jueves 25.08.2011 / 16:06
que onda chicos q transa con ustedes ailesva un saludito iun ve3sito para todos

barrio 7 ( e-mail: )
Jueves 25.08.2011 / 03:24
mire pinche jarudillo P... ustedes son los osikones todo mundo sabe q los pinches jarudos son bien abladores nomas ladran pero asta ahy no les da verguensa P... nosotros si les demostramos con echos ya no saben otra pinches P... JA JA JARUDO YA SE ACABO se cren intocables weyes pero se los estan H... ando ya se la saben abladores BARRIO 7 SE LAS COCHA sigan ladrando P...

( e-mail: )
Miércoles 24.08.2011 / 15:26

JARUDO ( e-mail: LOKOS )
Martes 23.08.2011 / 10:27

nanei tu xikito stone ( e-mail: )
Lunes 22.08.2011 / 17:10
el unicoo naenie l dripil

EL CHAPO ( e-mail: )
Sábado 20.08.2011 / 11:03
falta poco chamakitos para gobernar el mundo entero ia veran pollitos quien es mero padre.

crislaine ( e-mail: )
Viernes 19.08.2011 / 10:16
mira mi face book es crislaine pausicles enviamelo hay ok mi mensaje es ( No preguntes por los caminos de la vida si no sabes caminar, ya que aunque te los muestren siempre estarás perdido.)

( e-mail: )
Jueves 18.08.2011 / 06:59
puro barrio 7 como les quedo el ojo pinches jarudos con el desmadre de anoche como siempre nos pelan la ustedes ya no exsisten pues esstan callendo como moscas y nonca asen nada Pd.SEGUIMOS ESPERANDO SU VENGANSA PENDEJOS AVER CUANDO LES TUMBAMOS OTRO PINCHE CHAVALILLO NOS LA PÉLAN ATTE: BARRIO 7 SUS PADRES

( e-mail: )
Sábado 13.08.2011 / 11:05

carlos mundo ( e-mail: )
Jueves 11.08.2011 / 09:10
H... ueen asu P... madree puñetas hijos de perraa pura pinchee lenguaaa idiotas

( e-mail: )
Lunes 08.08.2011 / 13:57

EL CHAPO ( e-mail: )
Lunes 08.08.2011 / 01:57
calmados polluelos que de aca riva los sigo viendo.ustedes asu jale chavalones por un mexico mejor.

( e-mail: )
Sábado 06.08.2011 / 12:52

( e-mail: )
Sábado 06.08.2011 / 06:30
ajjaja eres policholooo o q

PFP ( e-mail: )
Viernes 05.08.2011 / 17:05

( e-mail: )
Viernes 05.08.2011 / 12:31
mi compaa usted no mas abla por q tiene osicoo poes x esoo tenian comprados al director i alos custodios yo se q alos q mataron estvan el nuevo ingresoo no se P... compa.. io no abro por ablar

( e-mail: )
Jueves 04.08.2011 / 19:39
como se ban a matar los del mismo grupo si estaban en diferenrte seccion? no seas P... compa,no que muy sicarios,pues entrele a los putasos pues. el tal diego esta con la cola en las verijas temblando de miedo frente ala PFP pues noque muy sicario? y ahora sale con esa M... que nadie le cree.que los muertos eran del vando contrario.que no sea mamon y sacaton.yo por eso trabajo onrado y no ando con M... de esas.

( e-mail: )
Jueves 04.08.2011 / 12:58
jajaja poes mira el diario weii a sorry no saves leer... pero si tienes alguin q te lo lea mira el diario de ayer..jajajja

( e-mail: )
Miércoles 03.08.2011 / 16:18

( e-mail: )
Miércoles 03.08.2011 / 14:24
la riña del penal municipal que dejó 17 muertos fue entre propios integrantes de la organización que encabeza Joaquín “El Chapo” Guzmán jajajaja pobres P... se andan matando entre ellos....

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Miércoles 03.08.2011 / 13:57

GENTE VIEN ( e-mail: )
Miércoles 03.08.2011 / 11:58
Haver mis sicarios, cuanto valoras tu vida y las de los demas, ustedes se estan matando por una plaza, y cuando la ganen que va a pasar, seguiran siendo unos gatos para sus patrones? o les van a repartir los millones que ellos ganan gracias a ustedes, en esta vida nomas se vive una vez, no la desperdicien de esa manera no sean titeres de los carteles, para ellos tu eres basura te matan o te encierran y hay mas gente jodida igual que tu que te remplazara, pero en fin, ponte a pensar tu futuro 1 ano mas, igual de pobre, muerto o en la carcel. hay siguele

PRM ( e-mail: )
Miércoles 03.08.2011 / 08:07
Tiene usted mucha razon,mis mas grandes respetos para usted.tristemente las cosas son como usted las dice espero que muchos de nosotros las entendamos y vivir ya sin tanto desmadre.

GENTE DE JUAREZ ( e-mail: )
Miércoles 03.08.2011 / 05:31
Haber bola de pendejetes, ni uno de los 2 carteles sirve para nada, ustedes se estan matando para darle la plaza a su patron que nunca en su pinche vida vana a conover "chapo" o "vicente", les pagan una miseria y cuando los matan ni quie se acuerde de ustedes o a caso sus patrones van a su funeral, para ellos todos ustedes son carne de canon, hante la sociedad dan lastima, hantes un narco ganaba miles de dolares trabajando solo, ahora ya nunca van a salir de jodidos con la miseria que les pagan, ni si quiera pueden ir a una barra y pistear a gusto y festejar un jale, les doy 2 anos de vida a cada uno de ustedes al seguir con cualquier pinche cartel, pero hay siganle desmadrando juarez y hay los veo todos los dias en el PM cuando acaben muertos y sus pobres hijos y esposas pidiendo limosna por que ya se les fue el Papa al infierno y no se diga de sus padres, consiguiendo dinero para poder enterrarlos, en esta vida se vive una sola vez y realmente vivez FeliZ, es la vida que siempre sona

Martes 02.08.2011 / 16:42

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Martes 02.08.2011 / 16:21

( e-mail: )
Martes 02.08.2011 / 10:04

PRM ( e-mail: BORRACHOS )
Martes 02.08.2011 / 09:48
como vieron la fiesta en el penal??? estubo chida y para mala suerte ya agarraron al papa d los linieros y azcacas JAJAJAJAJAJAJA ahora si... QUIEN PODRA ALLUDARMEEE???? JAJAJAJAJAJAJA facil y con la izquierda les pusimos en su madre, solo las plumas q daron JAJAJAJAJAJAJA para q vean quien es LA PRM.

JARUDOLOKOS ( e-mail: )
Martes 02.08.2011 / 09:36

( e-mail: )
Martes 02.08.2011 / 05:48
pues gracias y el que se debe de cuidar es usted ya que los osicones no duran mucho.y tenga cuidado con las trocas sospechosas y trucha con su familia porque despues de este mensj sierto o falso se lo va a cargar su P... madre.

el fovia ( e-mail: )
Lunes 01.08.2011 / 17:19
mns para el drekk de los azt guache drek aora hoy un royo que los aa y los mx los estan esperando pero les ban a poner una trampa les ban a poner mucha jente para que maten pero son carnada x que lo que hoy fue que ubo una junta con el gobierno para acabarlos de una ves pero segun esto todo lo estan planiando los del gob para exterminarlos pues ya todo esta preparado segun escuche y el bato este dise que les ban a aser el 123 al tiro disculpe que se lo diga x este medio pero no alle otr manera cuidense y adios

juaritoz ( e-mail: )
Lunes 01.08.2011 / 16:35

pericko ( e-mail: WWW.ASIENDO GENTE.COM )
Lunes 01.08.2011 / 11:57

MR HUKLA ( e-mail: 45 KING )
Domingo 31.07.2011 / 13:35

Domingo 31.07.2011 / 06:51

FRUTERO ( e-mail: juaritoz )
Sábado 30.07.2011 / 12:28
a caray,pues si que andan recio.y si se quedan sin trabajo yo ya les avia dicho,yo les doy trabajo vendiendo fruta y ya dejence de P... y hagamos algo por los dice un humilde frutero que vive muy feliz con respeto se los digo.

PRM ( e-mail: MEXICLES )
Sábado 30.07.2011 / 11:14
pues cual plaza?? si ya la plaza es d CDS PRM, y eso solo es una pequeña muestra.VIVA MEXICOOOOOO.... VIVA LA PRM..............¡¡¡!!!

EL JUARENSE ( e-mail: )
Sábado 30.07.2011 / 09:03

( e-mail: )
Viernes 29.07.2011 / 19:32
jajja a ver ese de los AA dond stan los dms segun el paus y el fhat q era de jarudo... a orasi q salga para toparnos ... culosssss

( e-mail: )
Viernes 29.07.2011 / 19:21
poes iia no ai o esta descuartizados i los mataron como el carlos elm joto del jarudoo por ayaudar al fhat o alos de aa jajajajajajjaaj

( e-mail: )
Viernes 29.07.2011 / 18:28
dond stan los AA andaban buscando soin de jarudoo

( e-mail: )
Viernes 29.07.2011 / 18:02
jajaja wei si wei poes si aa andan abrigando alos jotos q atrabajen para ellos como estara el pedoo ajjaaja q le paso al q mataorn en jardo asie pcoo jaja

MR HUKLA ( e-mail: 45 KING )
Viernes 29.07.2011 / 16:09

juaritoz ( e-mail: )
Viernes 29.07.2011 / 15:36
pues yo tengo entendido que los muertos fueron de los aztecas y de la tal linea. y un prm o mexicles yo tengo un primo en el penal y me conto el rrollo. ahi con respeto sin ofender a nadie.

( e-mail: )
Viernes 29.07.2011 / 13:44

PRM ( e-mail: MEXICLES )
Viernes 29.07.2011 / 10:57
eso es todoooooo... la plaza es nuestra y un saludo con mucho respeto a los AA. puro PRM y no ganamos 100 dolares.jajajajajajaja

2AA ( e-mail: 2AA )
Viernes 29.07.2011 / 07:29

PRM ( e-mail: BORRACHOS )
Viernes 29.07.2011 / 07:12
Ya leyeron el menj d abajo stupidos?? haganle caso a ese mensj y no c metan con CDS PRM,x q les volvemos a partir su P... madreeee... puro PRM y AA CDS. o quieren mas desplumados?? jajajajajajaja.

amigo ( e-mail: )
Jueves 28.07.2011 / 19:03
miren chavos esto yo se que en estos momentos estan llenos de odio pero lo que asen es destruir juarez y austedes mismos x que ayer fueron de un bando los muertos aora de otro pero esto ya esta muy bisto recapasitren que es en bano es el diablo el que los manipula para caer en estos juegos pero detras de todo es el quien muebe los ylos detras de cualquier nascara sea el cartel o la pandilla ojala despierten antes de que sea muy tarde mejor si quieren pelear que sea x sacar a nuestra ciudad adelante ojala y puedan areglar sus diferiencias y ayga los lideres con sufisientes y poder para areglar esto llo se que lla a abido muertos pero es mejor enterrar a los muertos y no seguir peliando x acabarnos

( e-mail: )
Jueves 28.07.2011 / 16:27
pues ya c esta seas pendejo,bueno eso ya es d nacimiento PAREJITA D a 100.JAJAJAJAJAJAJA PURO CDL PRM. SOLO LAS PLUMAS QUEDARON JAJAJAJAJAJAJA

( e-mail: )
Jueves 28.07.2011 / 14:59
tiene toda la razon parejita pero este chaputo culoo solo abla por ablar al rato veremos qien es qien

MR HUKLA ( e-mail: 45 KING )
Jueves 28.07.2011 / 14:15

( e-mail: )
Jueves 28.07.2011 / 14:05

( e-mail: )
Jueves 28.07.2011 / 12:57
jajajaja piche chavo pondejo neta no saves lo q dises no saves lo q dises solo ablas por q tienes boca y eso [por q lo ves en las noticias pero no saves ni q pedoo mi compaa.. neta

Miércoles 27.07.2011 / 17:59

( e-mail: )
Miércoles 27.07.2011 / 15:42
un saludo para el spooki y smyle q estan en el cherri de parte de la gente del barrio q esten pasando tiempo chido i echenle ganas el michel

pericko ( e-mail: BYG AZTECAS # 1 )
Miércoles 27.07.2011 / 14:03

PRM ( e-mail: MEXICLES )
Miércoles 27.07.2011 / 09:56
Q les parecio la fiesta en el penal???? pinches panochudos,ustedes son panochas d a 100 JAJAJAJAJAJAJA NI PAL ARRANQUE NOS SIRVIERON JAJAJAJA. PURO PRM... PRM Y AA SOMOS LOS MAS CHINGONESSSSSSSSSSS... ahha. y no ganamos 100 dolares JAJAJAJAJAJAJA....

Lunes 25.07.2011 / 17:00
Huuuuyyyyyy,jajajajajaja,huuuuuuyyyyyyy jajajajajajaajajajaja.mejor yo t pago los 100 dolares, yo t los pago para Q BALLAS A CHINGAR A TU PUTA MADREEEEEEEEEEEE..........JAJAJAJAJAJAJAJAJAJAJA

pericko ( e-mail: DE LA COL.SANTA MARIA )
Lunes 25.07.2011 / 16:00
Biendicho carnal par de putos si asison parteputos aaa es que se cren sicarios de la gente de el chaputo Traisionero par de mayates mejor cudense culones salgale al tope

PRM ( e-mail: AA )
Domingo 24.07.2011 / 18:03

clavo ( e-mail: )
Domingo 24.07.2011 / 17:34
mire mi dreck le recomiendo que mire la pelicula el principio del fin x que es lo que su organizacion representa y me recuerdan a un serio de este tiempo hay te miro sapo y acurdate a qui con clavo y el prm te sientas x que no sotros no somos una pinche linea somos una cadena puro prm y blindados aa y a todo el clan

PRM ( e-mail: BORRACHOS )
Domingo 24.07.2011 / 16:36

clavo ( e-mail: )
Domingo 24.07.2011 / 16:14
jajajaja que les paso u tus carnales en paral hay me saludas al morado jajajajaja y si agarra bandera de juarez pero tus hilos bienen de las pinches trensudas del chucko me das risa marrano y tu jente tambien los esta bendiendo por que crees que se les estan callendo todos los jales y callendo los de ariiba y cmo dise mi carnal pidan chichi con quien quieran que a nosotros tambien nos respaldan los de ariba y puro mexico sombis

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Domingo 24.07.2011 / 14:52

PRM ( e-mail: BORRACHOS )
Domingo 24.07.2011 / 11:49

clavo ( e-mail: )
Domingo 24.07.2011 / 10:23
mire mi drekk nos pelaron la V... al principio y nos ban a pelar la V... x siempre sigan agarrados de la V... de los linieros x que aber si de los dos se ase uno mi jente sigue al 100 y casando marranos lla lajente se esta dando cuenta de lo basura que son y cada dia mas jente despierta a la revolucion y acabaremos con tu pinche jente que a benido a invadir mexico telo prometo marrano yo y mi jente estamos al 1000 con el prm x que soy de juarez y mi jente es de juarez y yo si camello como se debe camellar x que mi jente si sabe como se debe correr el jale x eso seguimos presentes saludos y respetos paro todos los borrachos y sus cantineros y a camellar que esto es asta acabar contodos los marranos

( e-mail: )
Domingo 24.07.2011 / 09:02
ooo entoces los prm son chaputos o q

( e-mail: )
Sábado 23.07.2011 / 18:50
y con quien anda jalando gamaliel?? para cual grupo trabaja??

( e-mail: )
Sábado 23.07.2011 / 17:40
gamaliel hernandez vive en 730 san enrrique colonia santa magdalena tiene un carro probe negro y uno todo despintado rojo con gris contactalo en facebook como gamaliel hernandes, y avisale de esto! gacias

( e-mail: )
Sábado 23.07.2011 / 17:21
jaime gamaliel hernandes es amigo del extorcionador apodado el jarocho de los que acaban de torcer , y tanbien tienee que ber con crimen organizado! encuentralo en facebook como gamaliel hernandez su foto es el logo de heroes del silencio

pericko ( e-mail: Aztecas de la col.santa maria 13 )
Miércoles 20.07.2011 / 17:19
siges de tira royo P... dime donde nos bemos pinche marica tu y tugente no son nada jajjajaja ya sabes quien te cochala___________________

PRM ( e-mail: BORRACHOS )
Miércoles 20.07.2011 / 16:15

pericko ( e-mail: Aztecas de la col.santa maria 13 )
Miércoles 20.07.2011 / 15:15
pinches revulusionarios ni se oye de ustedes puro pinche rollo pinches mocosos pongase aser otra cosa de estar todo el dia en el pinche internet nosotros apollamos al CARTEL DE JUAREZ para que sepan cuando quieran caigale al BARRIO PARA PARTIRNOS LA MADRE HPS 3 COL.SANTA MARIA SOY EL GASELA PUTOS Y ANDO CON LOS DE LA LINEA AL MILLON ACABADO CON LOS PINCHES MOCOSOS DE LOS MEXICLES DE MIERDAS -_____________________________AL MILLON MI DREECK

PRM ( e-mail: BORRACHOS )
Martes 19.07.2011 / 16:55
Quien pregunta y para q?????

( e-mail: )
Martes 19.07.2011 / 11:17
eiiii q es prm

Lunes 18.07.2011 / 14:06
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja LA PRM CHAMBENDO MACHIN.

Lunes 18.07.2011 / 14:02
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja

Lunes 18.07.2011 / 14:02
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja

Lunes 18.07.2011 / 12:46

( e-mail: )
Lunes 18.07.2011 / 08:02
wawawaawa,sr.calderon ya no podemos con la gente del chapo porfavor alludenos sr.precidente necesitamos que hable con la gente del chapo para que nos deje trabajar porque nos estamos muriendo de ambre porfavor sr.precidente calderon mire ya estamos llorando WAWAWAWAWAWAWAWAWAAAAAAAA !!!!!!!!!!!!!!!!!!!!

Domingo 17.07.2011 / 16:12
yo lo adopto y le doy trabajo para que lla no ande de bago causando lastimas y pasando ambre.

Domingo 17.07.2011 / 15:41
si,un mendigo que se vende por pinches cien dolares jajajajajajajaja ya ni para tragar tienen. mejor dile al tal frutero que te de jale ajajajajajajaja saves quien soy?? soy PRM quien se cojio a tu madre porque soy tu PADREEEEEEEEEEEEEE. JAJAJAJAJAJAJAJAJA.

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Domingo 17.07.2011 / 14:29

PRM ( e-mail: BORRACHO )
Domingo 17.07.2011 / 11:41

clavo ( e-mail: )
Domingo 17.07.2011 / 08:05
saludos y respetos carnal de parte de los carnales que transa carnalito que a pasado en juaritos benimos bajando de parral los carnales isieron unos acomodos alla y andabamos dando esquina pero aqui estamos al 100 aqui sigue cresiendo la famili aunque ay otros cabesones que andan de bacaciones x la famili pero estan al 100 aqui bamos a calar a los esquinas que ba a ber que aser barios jales pendientes x que hay mucho jale que aser

BORRACHO ( e-mail: PRM )
Sábado 16.07.2011 / 04:12
REVOLUCIONARIO 713,que pues carnal? a q se refiere con su comentario????? con respeto Tigre Consagrado.

Revolucionista 713 ( e-mail: )
Viernes 15.07.2011 / 20:10
Nombre les digo aqui estoy wachando todo este rollo.... tantos reglas que se han quiebrado con tantas faltas de respeto lo que paso paso yo estuve entre el desmadre en varias prisiones ya que muera hay!!! Para todos los borrachos aqui? portasen bien carnales no estamos para entretener el publico nos nuestra onda

Viernes 15.07.2011 / 06:38

Jueves 14.07.2011 / 17:34
jarudos hay con respeto la morra rocio sigue con ustedes? yo coloreo a algunos jarudos y son chidos y tambien coloreo ala rocio pero no se si aun es jarudo.

Jueves 14.07.2011 / 13:38

Jueves 14.07.2011 / 09:53

Jueves 14.07.2011 / 09:08

MY * DREECK* ( e-mail: BYG AZTECAS # 1 )
Miércoles 13.07.2011 / 14:15

( e-mail: )
Miércoles 13.07.2011 / 10:00
que mendigos y muertos de ambre estan estos narquillos de los aztacas trabajan y son achichincles de la linea y por 100 pinches dolares son gatos de estos weyes linieros.yo vendo fruta y gano 150 dolares y no ando con M... que soy narco y menos que soy gato de alguien.yo trabajo solo.estos weyes solo dan lastima y risa.

( e-mail: )
Miércoles 13.07.2011 / 06:51
pero los AA son compañeros de los PRM.y esos tambien son gachos.

( e-mail: )
Martes 12.07.2011 / 17:10

( e-mail: )
Martes 12.07.2011 / 16:52

NO ALA VIOLENCIA ( e-mail: )
Martes 12.07.2011 / 11:44
si hay que terminar con estas lacras que solo ensucian cd juarez y todo mexico.juntos la policia y el pueblo bamos a terminar con estas bacterias de aztecas linias y todas esas pandillas mediocres que solo dan lastima y felicidades por esos 240 añ juarez necesita vivir en paz.

JUARITOZ ( e-mail: LIBRE )
Martes 12.07.2011 / 10:03

Lunes 11.07.2011 / 12:07

Viernes 08.07.2011 / 12:46
que casualidad.nosotros solo eramos 5,2 en la puerta,1 en las mesas,1 en el estacionamiento y yo en la barra. que casualidad que no nosvieron.jajajajajaja.dejen de hacerle al wey. son culos y comprobado esta. bueno ya no tengo tiempo de tirar rollo con perdedores como boy hacer villetes hay los dejo por un rato.puro PRM .....

Viernes 08.07.2011 / 11:52
que rollo con los prm puro royo de esos putos yo fui y no abia nadie de tu gente mocosa puro royo de esos putos que se cren narcos pinches locos somos del V*B*T*13

Viernes 08.07.2011 / 06:02
Ora jotolones.pues los estuve esperando anoche y nada que llegaron, te digo que tienes miedoooo.ya lo e comprobado muchas veces y esta fue una mas. PARA TODOS LOS QUE LEEN EL MURO UNA VES MAS LES INFORMO QUE LINIEROS Y AZCACAS SOLO TIENEN OSICO Y NO ATORAN SAVEN QUE CON LA PRM NO PUEDEN NI PODRAN. ME QUEDASTE MAL LINIERO PERO YO ENTINDO TU ERES GATO, UN ACHICHINCLE QUE RECIBE ORDENES Y CLARO ESTA QUE NO TE DEJARON IR. orale pues hay se ven COYONESSS... puro PRM

PRM ( e-mail: MEXICLES )
Jueves 07.07.2011 / 08:36
que pues rajones?? no que muy entrones?? les digo que ustedes puro osicooo... lo unico que corren es la lengua.jajajajajaja ven una troca y se mean de miedooooo. hay se ven coyones me boy hacer feria hoy boy a estar en el VAQUERO yo personalmente estare hai hasta las 11 de la noche.aver si llegan.jajajajjaja puro PRM PURO MEXICANO borrando lineas y desplumando azcacas. hoy jueves hasta las 11.

PRM ( e-mail: BORRACHO )
Jueves 07.07.2011 / 06:04
a quien??? aun achichincle,pela gatos mugroso como tu?? PRM y una raya mas al tigre.cuando tienes tiempo.

MR*PERICKOTE ( e-mail: )
Miércoles 06.07.2011 / 15:58
ajajjajaja le sacas prms de mierdas estoi en la jilo P... caile

PRM ( e-mail: MEXICLES )
Miércoles 06.07.2011 / 12:15
Ustedes an de ser inmorteles weyes ya perdi la cuenta de los que yo personalmente me e H... ado.los dos ultimos que me ejecute solo aguantaron 1 balaso en la cabeza. o sea que no son muy intocables putos. yo empese a desplumar azcacas des la pricion no soy gato como tu. puro PRM P... y que sigan los muertitos jajajajajajja.

MR*PERICKOTE ( e-mail: )
Miércoles 06.07.2011 / 11:49

( e-mail: )
Martes 05.07.2011 / 12:25
un saludo para todos los del barrio papalote en la colonia del carmen de parte de parte de michel

shagyOneR ( e-mail: doble u efe uno )
Sábado 02.07.2011 / 15:49
k roio muro ps aki mandado saludos desde tierra new ok ya c la saben by shagyoner wfones mis chavos ok jejeje world five lokos

Sábado 02.07.2011 / 14:23
Que tan serca puedes estar pendejo. todos los dias dices lo mismo y sigo desplumando azcacas y borrando lineas.mientras ustedes corren el osico y se esconden de miedo nosotros hacemos billetes y ganamos mas plazaaaa.puro PRM PURO MEXICANO y no solo en juarez EN TODO EL PAIS bola de jotos puñales.jajajajajajjaja PRM

Sábado 02.07.2011 / 10:04

sami ( e-mail: )
Sábado 02.07.2011 / 07:37
asi es pareja son CULONES ustedes PRM y lagente del CHAPUTO no se quieren dar un tope con los de la LA LINEA por que les parten en su MADRE berda prm de mierdas salgale al toorroo sinnalos jjjajajjajaja apoyamos a los de la ciudad CDJpara que te quede CLARO O CUAL ES TU MIEDO?????????????

Sábado 02.07.2011 / 06:23
sigues de idiota liniero yo tambien ya te dije que eres un triste microbio, una lagartija del desierto. puro PRM PRM COMPAAAAAA....

MR*PERICKOTE ( e-mail: )
Viernes 01.07.2011 / 23:46

PRM ( e-mail: BORRACHOS )
Viernes 01.07.2011 / 16:45
son culos los linieros y azcacas y su cartel de lastimas.que pinches miedosos son ustedes.puro CDS Y puro PRM.

MR*PERICKOTE ( e-mail: )
Viernes 01.07.2011 / 14:48

PRM ( e-mail: BORRACHOS )
Viernes 01.07.2011 / 12:38
esos idiotas linieros y azcacas son coyones no le entran ala PRM en apollo amis carnales BORRACHOS Y CARTEL DE SINALOAAA. CD JUAREZ ES DE NOSOTROSSS.... puro PRM.

EL PELON ( e-mail: )
Viernes 01.07.2011 / 11:13
esos putos de los prm lla le sacaron al tope SON CULONES EN APOÑO AL DREECK ya los traemos de el C...

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 16:05

MY DREECK .V* B*T*13 AZTECAS ( e-mail: )
Jueves 30.06.2011 / 13:27

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 12:06
esas M... ni tu te las cres.todos los dias dices lo mismo y yo no veo nadaaaa.y lo que menos hacemos es quedarnos en casa pues andamos por todos lados y ustedes ni nos ven.fijate lo P... que son ustedes ni siquiera se dan color donde andamos.y nosotros los tenemos bien ubicaditos(FE Y VIDA,VILLAS DE SALVACAR).ya mejor cambiale de rrollo porque la neta ya fastidiaste a todos los del muro.hay se ven JOTOLONESSS. puro PRM PRM PRM COMPAAAAAA.....

MR*PERICKOTE ( e-mail: )
Jueves 30.06.2011 / 11:20

Jueves 30.06.2011 / 06:26
estodo BORRACHOSSS. y que putos?? ahora ustedes son los mudos??? jajajajajaja...juarez es nuestro puro CHAPO GUZMAN puro PRM.

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 05:44
ustedes 2 P... lo unico qoe corren es el osico.ya cd juarez es de nosotros PRM presente en cd juarez y todo mexico. y ustedes no salen de su mismo lugar por culos y miedosos.ya valieron madre sin terreno ni gente ni feriaaaa.pobres P... ahora dan mas lastima que antes.puro cartel de SINALOAAAAA PURO PRM PRM PRM PUTOSSSSS...

EL PELON ( e-mail: )
Miércoles 29.06.2011 / 15:05
se quedo mudo pareja saludos a toda mi gente de la linea de parte de el pelonsote ya se la saben con esos peros se ban a caer solo mas esos prm de mierdas estamos listos mi dreck controlando cdj los chihuahua zona de EL CARTEL DE JUAREZ.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: )
Miércoles 29.06.2011 / 12:51

PRM ( e-mail: BORRACHOS )
Martes 28.06.2011 / 03:58

Lunes 27.06.2011 / 13:33

Lunes 27.06.2011 / 13:14
No pues ustedes tambien se abientan unos chistes buenos y nosotros y muchos mas tabien nos reimos jajajajajajajaja...y que lentos son ustedes tienes 3 meces ubicandome y luego que ya me ubicaste y luego que me sigue buscando.pues ya decidete. todo parece que me tienes miedo. bueno todos ustedes son bien jotolones comprobado esta.dime cuanto tiempo te sigo esperando?? o necesito apañar a no de ustedes ppara que vengas mas rapido?menos vienen ya me H... ue a 2 y nunca vinieron por ellos.puro PRM COMPAAAA.

EL PELON ( e-mail: SANTA MARIA 13 )
Lunes 27.06.2011 / 11:30

PRM ( e-mail: MEXICLES )
Lunes 27.06.2011 / 04:42

MR * DREECK COHON ( e-mail: )
Domingo 26.06.2011 / 14:47
ey y que les a pasado a tu gente que llani los beo sigeRECLUTANDO MOROS JAJAJAJAJJAJA YA BES LOS QUE LESPASO ????????

PRM ( e-mail: BORRACHOS )
Domingo 26.06.2011 / 07:47

MY DREECK .V* B*T*13 AZTECAS ( e-mail: )
Domingo 26.06.2011 / 03:15

rip klens ( e-mail: )
Sábado 25.06.2011 / 20:47
dezcansa enpass mi kleens siempre te llebaremos en nustro corazones fuistes uan bergaa k nadie puro parar te agarraron descuidado i sin kuete solo los marikas agarran por atra pero dezcansa estas mejor aya en el cielo biejo RIP KLEENS JARUDO LOKOS

mard ( e-mail: )
Sábado 25.06.2011 / 20:25
esot es para todos akellos ke cren peliar por algo ke les pertenese sin tener consiencia ke no es asi yo fui pandillero por mas de 8 años empese a los 13 años y ase dos deje eso por ke vi cosas ke muchos chavos ven solo por ensima ahora tengo 24 años y no digo ke no experimenten pero algun dia todos nos arrepentimos de aser cosas sin un sentido chavos piensen las cosas mejor y piensen no solo en ustedes en sus familias hermanas hermanos padres tios sobrinos incluso hijos ke muchos ya tienen ke dios los bendiga a todos y este con ustedes en esos momentos bye

PRM ( e-mail: MEXICLES )
Sábado 25.06.2011 / 07:42
PRM. familia con honor,lealtad,valor,principios y soberania. eso es lo que es LA PRM.UNA FAMILIA CON HECHOS. "ORGULLO PRM. ORGULLO REVOLICIONARIO"PURO PRM.

ALFA ( e-mail: )
Sábado 25.06.2011 / 05:40

Viernes 24.06.2011 / 16:17

PRM ( e-mail: MEXICLES )
Viernes 24.06.2011 / 11:55

ALFA ( e-mail: )
Viernes 24.06.2011 / 11:10

sHORE ( e-mail: )
Viernes 24.06.2011 / 11:07

MR * DREECK COHON ( e-mail: )
Jueves 23.06.2011 / 14:27

MR * DREECK COHON ( e-mail: )
Jueves 23.06.2011 / 12:26

PRM ( e-mail: BORRACHO )
Miércoles 22.06.2011 / 11:50

Miércoles 22.06.2011 / 10:47

Miércoles 22.06.2011 / 10:07
que tranza putoss el SONDOO del jarudo LOkoss..!!!

juaritoz ( e-mail: )
Miércoles 22.06.2011 / 09:26
que grasero es el tal diablote.asi le hablas a TU PUTA MADREEEE ???? no sea mal hablado.

diablote ( e-mail: wfzotes )
Miércoles 22.06.2011 / 08:16
wfzotes wf wfff locotes b. corunota

lokote el diablo ( e-mail: www.corunota wf .com )
Miércoles 22.06.2011 / 07:29
ke tranza putos pinchis bola dde perras flacas aqui el diablo calandolos a todos esos que de P... nacieron saludenme a sus carnalas putos me pelan la vergotttotota un huevo y la mitad del otro pinches becerros att el diablote

anonimo ( e-mail: )
Lunes 20.06.2011 / 06:11
saluds para el guero de los amos xv. eh mijo todavia t stoi sperando

FMC ( e-mail: )
Viernes 17.06.2011 / 20:33

PRM ( e-mail: MEXCALEROS )
Jueves 16.06.2011 / 15:41

Jueves 16.06.2011 / 14:34

PRM ( e-mail: MEXCALEROS )
Jueves 16.06.2011 / 07:07
Si es verdad, la violencia esta muy cabrona lo mejor es no meterse en problemas. y explicarles a los morros que se creen valientes que la vida solo es una y que se acaba en un segundo.

yo ( e-mail: )
Miércoles 15.06.2011 / 22:46
la guerra esta bien cabrona en juarez no se sabe de donde te ba a llegar ! aun que seas un cholo macuarro te matan es muy peligrosa esa ciudad!

PRM ( e-mail: BORRACHOS )
Miércoles 15.06.2011 / 15:48
Gracias carnal y digale a los BORRACHOS que espero pronto verlos y meda H... o de gusto que el lito ya ande fuera de la jaula ese es un gustaria ser yo quien agarre a ese P... para regalarle una cobija calientita,pero en eso andamos en la caseria de pieles rojas.puro PRM puro CORAZON MEXICANO. si puede me manda su directa para piztear machin.

clao ( e-mail: )
Miércoles 15.06.2011 / 14:44
saludos carnal y saludos de los canales le manda saludos l negro a se unos dias se abeno un jalesote mis respetos y lo atoraron al carnal peroo lla esta afuera no le isieron nada y se carcajea x los marranos el senor en caliente no lo eccho pa fuera lla andamos x ese dreeck pero ni en juarez o conosen x que los de ese barrio noi lo conosen pero ni modo x ese mocoso ban a mamar algunos mejor limpienlo ustedes mismos jaa

PRM ( e-mail: BORRACHOS )
Miércoles 15.06.2011 / 11:01
y a ti como al panochudo del imss 35.... que pedo no contestas nada de lo que se te dice en mensjs abajo. PORQUEEE???? por puro pinche miedooo. puro PRM compa....

Miércoles 15.06.2011 / 10:38

pollita ( e-mail: )
Miércoles 15.06.2011 / 09:18
aii shikititos ia no se pelen tantooo la mafia no deja nadaa buenoo atte.rita S

eL LoRsWaaN1 ( e-mail: FUMO MOTA AL 100 )
Martes 14.06.2011 / 20:37
He mii Sondo ay tamos pa lo ke se ofresca homii ya se la save pal paro tambien pa su gente ay tamos karnal chida

PRM ( e-mail: mensaje para las linias y azcacas )
Lunes 13.06.2011 / 17:41

PRM ( e-mail: mensaje para los panochudos linieros y azcacas )
Lunes 13.06.2011 / 12:10
que pues ratas de basurero,ustedes solo sueñan con ser grandes,estan muy verdes para ser limones.aun siguen paniquiados con lo de FE Y VIDA. porque si solo fue una pequeña muestra? luego 2 azcacas le jugaron al heroe y los tubimos guardados por 2 meces esperando que 1 de ustedes linieros vinieran por ellos y NADAAA. nunca vinieron pues porque?? pues que no son camaradas? si ustedes son marranos del mismo corral.por lo C... que son los dejaron morir en el cerro. que miedo dan ustedes...ustedes no intimidan a nadie lo unico que causan es LASTIMAAA.y te lo dice 1 PRM y yo encobije a tus 2 camaradas. y queeee????

( e-mail: JARUDOLOKOTES! )
Lunes 13.06.2011 / 11:06
ui ui qe miedo ! todos en este perro mundo estamos PIRATAS

Lunes 13.06.2011 / 10:51

( e-mail: ____________ )
Lunes 13.06.2011 / 09:50
JUARITOS RIFA! ____________

PRM ( e-mail: MEXICLES )
Sábado 11.06.2011 / 14:09
la PRM precente y reprecentando a todos los BORRACHOS.animo gente todo anda MUY BIEN. "PRM".

( e-mail: )
Sábado 11.06.2011 / 13:27

Sábado 11.06.2011 / 13:24

Sábado 11.06.2011 / 13:18

Juaritos ( e-mail: )
Sábado 11.06.2011 / 11:05
disculpen y con respeto les pregunto.quienes son los longos??? pregunto para no tener problemas con nadie pero ya abia escuchado algo de longos.gracias y disculpen espero me digan qienes son los longos.

yanerote ( e-mail: )
Sábado 11.06.2011 / 08:43
nel prm no tengo nada contra ustedes ni con jarudo pero una tranza si les digo no soy osicon y a los jarudos les pido perdon x una tranza k mi tio cometio ase muchos anos ase como 15 masomenos no c si decirles x este medio ,, como ustedes kieran pero c lo cuentan a los longos x favor

( e-mail: )
Sábado 11.06.2011 / 08:32
yo cometi un error ase rato parecido con lo k paso en el jarudo pero uno como sabe kien anda en pedos y kien no somos adivinos cuando cueteo tiro a la pinchi bola y luego salen conke apenas empesaba en el barrio o k el no era del barrio,y yo c tranzas del jarudo canalito k tu ni t acuerdas ese kieres k t diga una o k tranza

yanerote ( e-mail: )
Sábado 11.06.2011 / 08:23
nel ese yo nomas digo la neta aunke les cale hueyes,andan con sus pinches M... k un paro a los prm devolada ay tamos y la H... no son prm mandenlos a la V... y punto salganle solos ,, o sino amarrence un huevo x k les tumban a otros,.. abajo escribio un huey diske de los longos pongan su pinhe nombre no sean culos

PRM ( e-mail: MEXICLES )
Sábado 11.06.2011 / 07:54
son muchos los vatos osicones,pura mugre de juaritos.a esos verijones que corren el osico se les avisa: EL JARUDO NOOOOO ES SQUINA DE LA PRM, EL JARUDO CORRE SOLO Y ES BARRIO. PERO ES RAZA Y ALA RAZA SE LES APOYA. MUCHO CUIDADO CON HABLAR MAMADAS PORQUE LO QUE NOS SOBRAN SON COBIJAS Y LLELERAS. entendidoooo??? yo no me ando con M... y ME VALE MADRE PADRES O HERMANOS y si les quedan dudas chequen el jale del centro de reabilitacion FE Y VIDA.

( e-mail: B.JARUDO )
Sábado 11.06.2011 / 07:38
calmese pinchi llanero ni sabe que pinchi rollo we,, y que le valga V... la informacion del jarudo canaa,,JARUDOTELOKOS

PRM ( e-mail: BORRACHOS )
Sábado 11.06.2011 / 06:05
la PRM esta limpia,fue un vato que hablo por el jarudo pero tengo entendido que el jarudo NO estubo de acuerdo.ala PRM le aguita ese jale que H... uen a morros que no quieren pedo.el punto es el ubicar a ese vato que andubo hablando por el jarudo y darle unas probable que ese vato leea este muro y ya este enterado.pero para entenderlo mojor leean los correos de este muro. con respeto y apoyo "LA PRM".

el yanero ( e-mail: )
Sábado 11.06.2011 / 04:28
k royo jarudos x k yoran dicen k les tronaron a gente k no andaban en pedos . si les asen paro a los prm aguanten la V... si no no agan paro a ninguna mafia y listo,...... el pancho era el lider del barrio o puro pedo?

PRM ( e-mail: MEXICLES )
Viernes 10.06.2011 / 09:31
asi es, la P... linea no sirve para nada.son culos igual que los cochinos azcacas.

Viernes 10.06.2011 / 02:11

PRM ( e-mail: borracho )
Miércoles 08.06.2011 / 10:36
Que pues BORRACHINES??? aqui su carnal ARVIZU alpendiente de la PRM esperando como los buitres. puro PRM RAZZZAAAAAA::::

123 ( e-mail: 123 )
Miércoles 08.06.2011 / 10:29

PRM ( e-mail: MEXICLES )
Lunes 06.06.2011 / 11:56
Oyeme cabron.sigo esperando a que me ubiques segun tu ya tenias toda mi libreta.PUES QUE PASA??? TIENES MIEDOOO??? NO VERDAD.los azcacas son culos incluyendote a ti,solo corren el osico y no ban a dejar esperando como a sus 2 camaradas? oye aun siguen resando el novenario para los de FE Y ESPERANZA? puro PRM.

Lunes 06.06.2011 / 10:45

SHAGYOneR ( e-mail: WFSOTES** )
Domingo 05.06.2011 / 03:54

PRM ( e-mail: MEXICLES )
Viernes 03.06.2011 / 11:23
que pues raza?? un saludo para todos los BORRACHOS REVOLUCIONARIOS que siempre reprecentan machinn.ANIMOOO QUE TODO ESTA SUPER BIIIEENNN¡¡¡¡ puro PRM.

SONDOLOKONEE.. jarudote ( e-mail: )
Viernes 03.06.2011 / 10:43
el sondo putos del jarudote lokotess..!! la seguimos rifando hijos de su pinchi madre! somos barrio putos no necesitamos de mafias para ser vergas

( e-mail: )
Jueves 02.06.2011 / 20:29

( e-mail: )
Jueves 02.06.2011 / 20:22

JARUDOTES,, ( e-mail: )
Jueves 02.06.2011 / 06:53
ese pinchi mokoso tira mucha pinshi M... jajajaja das risas wey no mame,, a los jarudos nadie nos controla P... tus pinchis aztecas no la pelan cana por algo se la an pelado,,jarudotes putosss..!!

PRM ( e-mail: MEXICLES )
Miércoles 01.06.2011 / 12:37
y la PRM vicitando centros de reabilitacion para alludarles alos linieros y PRM les alluda a que se reabiliten mas pronto y los deja muy encobijados disque porque el frio esta cabron...

Miércoles 01.06.2011 / 11:10

SHAGYONER ( e-mail: dOblE U eF SOTeS )
Martes 31.05.2011 / 13:38

Martes 31.05.2011 / 07:38
Que pues raza ¡¡!!! aqui 1 BORRACHO mas de los muchos que hay reprecentando la"PRM" y borrando lineas de drogadictos. QUE NOOO????

CDS GUZMAN LOERA ( e-mail: )
Lunes 30.05.2011 / 19:37

PRM ( e-mail: BORRACHO )
Domingo 29.05.2011 / 10:43
Huy cucuy...QUE MIEDOOOO¡¡¡¡

Jueves 26.05.2011 / 01:22

Miércoles 25.05.2011 / 12:23

Miércoles 25.05.2011 / 11:03
asi cañaditos seben mas bonitos jaja

Martes 24.05.2011 / 11:12

Martes 24.05.2011 / 10:23

jarudote ( e-mail: el kleens )
Lunes 23.05.2011 / 16:41
arre mi compa clavo ay estamos puestotes BJL siempre presente carnal,,un saludo a toda mi gente y morras del jarudo ay estamos gente.

clavo ( e-mail: )
Lunes 23.05.2011 / 15:16
saludos carnales de parte de su carnal clavo y el negro nuetros respetos para usted y los bjl hay que estar siempre firmes pero siempre preparados todos nosotros estamos al 100 y camellando me dariA mucho gusto conoserlo y brindarle nuestros respetos pero entendemos como corre el pedo por este medio pero agarre nuestros respetos para usted usted sabe que todo se cammella x sentido comun y este marrano del dreck que lo quiere ubicar que digga don de nos damos un tope a nosotros tambien nos morimos x bicarlo al perro y usted siempre estara respaldado x la prm y x mexicles y afiliados los carnales guachan esta pajina y se queman todos los rollos que aqui se tiran pero lamentan que no podamos estrechar manos y a esos marranos de la linea y aztecaz el senor tambien les a mandado muchos videos digale ala sup que no los quite el publ tambien los quiere ber llorar jajaja

Lunes 23.05.2011 / 10:22

PRM ( e-mail: MEXICLES )
Jueves 19.05.2011 / 15:53
Que pues,cual plaza?solo que el mercado.ya no tienen plazaaaa... ustedes son tan culos que no salen de cd juarez ¡¡¡mira P... LA PRM ESTA EN TODO CHIHUAHUA,TIJUANA,REYNOSA,MATAMOROS,NV LAREDO,SINALOA,DURANGO,GUERRERO , DF Y GUANAJUATO.dime, como ustedes infelices microbios piensan terminarnos con LA PRM ? ustedes estan tan mendigos que ni pal pasaje tienen.bueno, pero si le resan el novenario a los de FE Y VIDA? y a tus 2 camaradas que dejaste aca conmigo los dejaron morir solos .QUE GACHOS NOO?jajajajajajajaja¡¡¡¡¡¡

Jueves 19.05.2011 / 14:27

Jueves 19.05.2011 / 11:16

PRM ( e-mail: MEXICLES )
Miércoles 18.05.2011 / 10:58
Oye pendejo? pues que LA PRM Y MEXICLES NO SON LOS MISMOS?? no conoces nada.putos AZCACAS se mean cuando ven a un PRM. PERO QUE NESIO ERES,NO ME DICES NADA DEL JALE FE Y VIDA'''???¡¡¡ ono saves nada??


PRM ( e-mail: BORRACHOS )
Miércoles 18.05.2011 / 10:48
Pues porque te tardas? mi gente esta por todos lados somos muy facil de encontrar. o tienen miedo por eso solo ladran.nunca vinieron por sus camaradas y me tome la molestia de dejarlos en el cerro con 1 oyo de 9mm en la cabezota.pero que pues?? dime algo del jale FE Y VIVA CENTRO DE REABILITACION.

Miércoles 18.05.2011 / 10:44

Miércoles 18.05.2011 / 10:39

PRM ( e-mail: MEXICLES )
Miércoles 18.05.2011 / 10:34
Miren pinches jotos,ya dejen de piratear videos chafas.esos jales son de los zz y ustedes no peinan un chango a nalgadas."LA PRM MEXICLES" les parte su madre facil y con la izquierda. que me puedes decir de los 19 muertos en "fe y vida"? sentro de reabilitacion.o no saves nadaaa? PRM MEXICLES SENTANDO azcacas. O NOOOO???

Miércoles 18.05.2011 / 10:32

Miércoles 18.05.2011 / 10:21

( e-mail: bjl! )
Martes 17.05.2011 / 18:23

( e-mail: B-JARUDO )
Martes 17.05.2011 / 17:46

PRM ( e-mail: BORRACHOS )
Martes 17.05.2011 / 15:55

B-JARUDO ( e-mail: B-JARUDO )
Martes 17.05.2011 / 13:38

( e-mail: BARRIO JARUDO ! )
Martes 17.05.2011 / 12:08
asi es carnal tienen el apoyo, i nosotros esperamos lo mismo de uds. pero no jalamos para nadien. encerio carnal esa pinchi tal rita nadien en el barrio la conoce ni nada no existe para nosotros, no necesitamos de una panocha qe nos defienda ) aiestamos

( e-mail: B-JARUDO )
Lunes 16.05.2011 / 13:51

PRM ( e-mail: MEXICLES )
Lunes 16.05.2011 / 11:56

( e-mail: B JARUDO LOKOS ! )
Lunes 16.05.2011 / 09:24

BJARUDOL ( e-mail: )
Domingo 15.05.2011 / 20:52

Domingo 15.05.2011 / 11:32

PRM ( e-mail: BORRACHOS )
Sábado 14.05.2011 / 14:08

JARUDO ( e-mail: )
Sábado 14.05.2011 / 13:41
dame tu correo prm..!!

PRM ( e-mail: MEXICLES )
Sábado 14.05.2011 / 09:07
Que pues JARUDO. necesitamos hablar dime como le hacemos. la otra ves les escribi a los correos que me diste y nada. estamos puestos.

Sábado 14.05.2011 / 08:53

Sábado 14.05.2011 / 04:41

Viernes 13.05.2011 / 21:57

Viernes 13.05.2011 / 20:38
el doef controlando en juarez y donde kieran chavalas y de ke le sirve ke tiren rollo lokos mejor densen de vergasos paresen niñas salgale por su barrio y de ke les sirve chapetes y juarez la riffa hay no mas y estamos en juarez aka del grangero no mas para ke wuachen y de la seventeen park and griffindoors smook weed brythay kana

PRM ( e-mail: MEXICLES )
Viernes 13.05.2011 / 16:17

Z 4 ( e-mail: C DG )
Viernes 13.05.2011 / 15:42
ese PRM porfavor reportece conmigo al correo o num del Z7 necesito toriquear con usted. con respeto Z4.

PRM ( e-mail: BORRACHOS )
Viernes 13.05.2011 / 15:32
putos osicones de los msf donde as visto que tu P... varrio visicletero se compare con "LA PRM" que no te das color de lo idiota que estas? solamente eres tu o tambien son todos los de tu varrio? yo pienso que solo eres tu el bastardo que sueñas despierto en ser alguien porque solo eres un misero microbio jugando a ser grande.

LA RITA ( e-mail: )
Viernes 13.05.2011 / 12:32

LA RITA ( e-mail: )
Viernes 13.05.2011 / 12:21 HAHA CREO K TE VA A PARESER BIEN MI IDEA

Viernes 13.05.2011 / 12:19
arres hay te va mija pasa el tuyo

LA RITA ( e-mail: )
Viernes 13.05.2011 / 11:52

Viernes 13.05.2011 / 11:47

LA RITA ( e-mail: )
Viernes 13.05.2011 / 08:09

jarudolokotees ( e-mail: )
Jueves 12.05.2011 / 16:09
arre we aqui te calmamos nomas no dures muchoo ee,, jajaja pinchi hablador P... jaja

Jueves 12.05.2011 / 14:32

PRM ( e-mail: BORRACHOS )
Jueves 12.05.2011 / 13:49
Simon JARUDOS ya tira al lion a estos hijos de puta, ya se esta calentando este muro y con puras stupideces de estos weyes que solo corren el osico alo pendejo. pero que no se pase de madre ese P... que insulta y falta el respeto a Rita que no se pase de pendejo. Rita ya tiene mi correo hay me escriben JARUDOS. y puro PRM Y JARUDOS los demas son OJETES.

BJL ( e-mail: )
Jueves 12.05.2011 / 13:31

Z 4 ( e-mail: C D G )
Jueves 12.05.2011 / 12:45

SHAGYOneR ( e-mail: WORLD FIVE OneS )
Jueves 12.05.2011 / 12:33

Z 4 ( e-mail: C D G )
Jueves 12.05.2011 / 12:25

LA RITA ( e-mail: )
Jueves 12.05.2011 / 12:08

Jueves 12.05.2011 / 12:03
QUE TRANSA PINCHES NIÑAS DE LOS JARUDOS LES BAMOS A CARE PÚTAS PARA QUE SELES QUITE LO CHINGONES CUANDO LES DEJEMOS 2 O 3 DECAPITADOS PERRAS TE ESTAMOS CHECANDO PUTA RITA YO EL DRFEECK TE BA A AGARAR Y TE BOY ADAR UNAS CIJIDAS ATTE DREECK DE LA COL.INDEPENDENCIA 1 Y 2 CAIGALE GENTE DE EL CHAPO Y LOS QUE QUIERAN PARA DARLES UN SUSTITO JAJAJAJAJJAJ__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-CONTROLA LA PLAZA

LA RITA ( e-mail: )
Jueves 12.05.2011 / 10:41

ZARAZUA ( e-mail: )
Jueves 12.05.2011 / 10:23
Busco a una amiga en Brownsville Tx se llama Maria Luisa Salas tiene 4 hijos la mayor se llama Inez,David y Alondra la mas pequeña vive en la calla coffe port rd no se el alguien la conoce porfavor reportenlo al muro.muchas gracias.

( e-mail: !* )
Jueves 12.05.2011 / 10:20
aceptame lepa !

la rita bjl ( e-mail: )
Jueves 12.05.2011 / 09:58

LA RITA ( e-mail: )
Jueves 12.05.2011 / 09:55

( e-mail: JARUDOTE! )
Jueves 12.05.2011 / 09:39
HAHAHAHAHAH! yononecesito qe una pinchi mocosa como tu defienda mi barrio, okei? dame tu P... correo lepa.

JARUDOLOKOS..!! ( e-mail: )
Miércoles 11.05.2011 / 12:40

LA RITA ( e-mail: )
Miércoles 11.05.2011 / 11:55

( e-mail: PARA RITA ! )
Miércoles 11.05.2011 / 11:02
e mija, ya cayese mejor ala E... puro mal qemon con ud, primero limpiese la pinchi cola bn ya se quien eres eres rocio, eres una pinchi lepa i yano digas nada porqe nadie te conoce estas bn cagada. le dire atu mama i atu papa para qe te pongan una putiza por abladora no sabes ni qe royo en el jarudo ni SALES JAJA! ke risa con tigo LEPA! tirenla alion vatos no es jarudo . ATT JARUDO

cesar ( e-mail: )
Miércoles 11.05.2011 / 10:51
no mamen la veerrga los dos peendejos ese we de los prmamones estan coochados al igual k el jarudo como la ben jejeje demen mas risa jejeje

LA RITA ( e-mail: )
Miércoles 11.05.2011 / 09:44

PRM ( e-mail: MEXICLES )
Miércoles 11.05.2011 / 05:47
La unica P... que conosco es tu madre y tu hermana y de bastardos solo tu. y la morra de los JARUDOS te pone una putisaa de a 100. ella es de ley no osicon como tu. tu eres como los demas microbios solo corren el osico a lo pendejo.siento que tu no vales la pena ya que lo P... se te ve desde lejooosss.y te lo dice tu padre LA PRM.

CESAR** ( e-mail: BDEU )
Martes 10.05.2011 / 18:12

LA RITA ( e-mail: )
Martes 10.05.2011 / 10:26

PR M ( e-mail: ARVIZU )
Martes 10.05.2011 / 09:31
Gracias Rita, yo se que EL JARUDO ES FIRME.ayer te mande un correo, si lo checaste? orale pues.

la rita bjl ( e-mail: )
Martes 10.05.2011 / 09:25

PRM ( e-mail: BORRACHOS )
Martes 10.05.2011 / 09:14
Para el tal cesar.tu que puedes saver de famas y menos de la PRM,lo mas conveniente es que sierres el osico apestoso.y la PRM le da respeto y la mano a quien lo a ganado y es ES EL JARUDO.como ves,coraje o envidia?? ademas no creeo que tu me vallas a decir donde y cuando escribir.o si?

LA RITA BJL ( e-mail: )
Martes 10.05.2011 / 07:59

cesar ( e-mail: b d e )
Lunes 09.05.2011 / 19:15
k ese we k esta poniendo k la prm y todo ese pinchi roio tekatote como el we k kreo k lo pone no mames wey losk andan en todo ese roio no andan con estas transas k poniendo H... aderas ni mamando huevos de barrios bale berga como las jaruda no mames wey es el muro del grafiti wey no para poner M... de narcos y asta culon eres we no pones kien eres de atiro vales V... putito

PRM ( e-mail: MEXICLES )
Lunes 09.05.2011 / 14:05
ya fastidiaron estos pendejos,en ves de dar coraje dan lastima y que putos linieros?ustedes son gatos de los azcacas.necesitan pedir permiso para hablar.linia?? linia la que traes en el culooo.ese P... escuincle de los msf dile a mama que ya te deje ver la TV y quedate en casa. puro "PRM Y BJL JARUDOOOOOOO"

LA RITA ( e-mail: )
Lunes 09.05.2011 / 13:32

LA RITA ( e-mail: )
Lunes 09.05.2011 / 13:26
oiie no te ddaaa verguenza ser de aii :O de ese barrio estupidoo TSS A MI SI ME DARIAAAA HAHAHAAA PURO BJL NO HAY MAS

( e-mail: RPSCREW! )
Lunes 09.05.2011 / 13:25
saca tu correo rita HAHA! qe no te saco

( e-mail: RPS CREW! bjl pacuando quieran JAJA! )
Lunes 09.05.2011 / 13:20
hahahahahah KETRANZA MI DRAW! kerisita campion hahahahah! mire mijo, la ves qe caimos como 50 hahaha eran los pelonsillos i barios jarudos haha como siempre jarudo pues pocos pero lokos, hahaha note miento peqeño preguntale al WIKE! hahahahaha como le iso alberga i lo devolvi a puro cuetazo hahahaha pero el ruko le iso al vergas HAHAHAAHHAHAHAAH! qe miedito un 3 80 NO ABLE mijo, MEJOR CAIGALE! HAHAHAHAHA! no able tanto menos internet i mas accion HAHAHAHAHAHA!

LA RITA BJL ( e-mail: )
Lunes 09.05.2011 / 13:14

LA RITA BJL ( e-mail: )
Lunes 09.05.2011 / 12:24

Lunes 09.05.2011 / 11:59
-______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-QUE TRANSA PUTOS MEJICLAS BALE BERGA EL DREECK LOS COCHA PUTAS JAJAJJAJAJAJA

PRM ( e-mail: MEXICLES )
Lunes 09.05.2011 / 11:40

jarudolokos ( e-mail: )
Lunes 09.05.2011 / 11:22
jaja pinchi jent abaldora como ben mis PRM con estos pendegos..ladran mucho como ben si los callamos lla jaja los msf ME DAN RISA SON PARA MI UNA BROMA BJL`PRM. UNA GRAN UNOS PURA ESKINA

Lunes 09.05.2011 / 08:47
el dreeck me cocha .jajajajajaja aliniensen traisioneros yano anden chapuliniando ette. tu maton el dreeck

PRM ( e-mail: BORRACHOS )
Lunes 09.05.2011 / 08:14

Domingo 08.05.2011 / 21:22

PRM ( e-mail: MEXICLES )
Domingo 08.05.2011 / 12:32

Domingo 08.05.2011 / 11:49

anonimo ( e-mail: juaritoz )
Domingo 08.05.2011 / 03:53
si msf tomen los consejos que les dan,ustedes aun son niños que merecen crecer y vivir trnquilos.los mexicles o PRM son ojetes son unos acesinos sanguinarios son cartel no son barrio.piensenlo muchachos y no se metan con esa gente acesina que solo les ba adar dolor y sufrimiento a sus mamas y familia.gracias por escucharme.

Domingo 08.05.2011 / 03:10
mira pinche escuincle pendejo,dejate de estupideces porque te estas metiendo en pedos grandes.aun sobran yeleras para ti y los putos mocosos que te acompañan.mejor ya no mortifiques a tu jefita con mas preocupaciones.te lo digo EN SERIO.dedicate a otra cosa y no te metas en problemas de esta tamaño. "te lo dice LA PRM MEXICLES".

JARUDO LOKOS ( e-mail: )
Sábado 07.05.2011 / 20:20

LA RITA ( e-mail: )
Sábado 07.05.2011 / 17:03

Sábado 07.05.2011 / 13:12

Sábado 07.05.2011 / 12:50

LA RITA BJL ( e-mail: )
Sábado 07.05.2011 / 07:23

W-FIVE OneS*** ( e-mail: WORLD FIVE ONES )
Viernes 06.05.2011 / 13:31

LA RITA ( e-mail: )
Viernes 06.05.2011 / 11:19

JARUDOTE ( e-mail: )
Viernes 06.05.2011 / 11:05

ARVIZU ( e-mail: PRM )
Viernes 06.05.2011 / 10:35
unsaludo a todos los homeboys y morras de "LA PRM Y EL JARUDO" que se vea ese animo al ciennn...puro corazon.

LA RITA BJL ( e-mail: )
Viernes 06.05.2011 / 09:29

EL SONDO..BJL ( e-mail: )
Jueves 05.05.2011 / 13:19

la rita ( e-mail: )
Jueves 05.05.2011 / 11:58

la rita ( e-mail: )
Jueves 05.05.2011 / 11:54

BORRACHO ( e-mail: PRM )
Jueves 05.05.2011 / 11:51

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:42

PRM ( e-mail: )
Jueves 05.05.2011 / 11:29
pues si pero si el vato te tiene ley no tienes de que preocuparte . bueno cuando puedas checa tu correo aversi ya te llegaron los correos ok. ya no hagas corejeeessss....

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:24

PRM ( e-mail: )
Jueves 05.05.2011 / 11:21

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:17

Laa RITA ( e-mail: )
Jueves 05.05.2011 / 10:55

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:33

PRM ( e-mail: )
Jueves 05.05.2011 / 10:30
Hola rita mi correo es

LA RITA BJL ( e-mail: )
Jueves 05.05.2011 / 10:29

Jueves 05.05.2011 / 10:27

LA RITAA ( e-mail: )
Jueves 05.05.2011 / 10:25

PRM ( e-mail: )
Jueves 05.05.2011 / 10:25

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:20

PRM ( e-mail: )
Jueves 05.05.2011 / 10:17
ya te mande un correo checalo y me escribes.

LA RITA BJL ( e-mail: )
Jueves 05.05.2011 / 10:13

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:07

PRM ( e-mail: BORRACHOS )
Jueves 05.05.2011 / 10:04
Hola Rita y un saludo a todo EL JARUDOOOOO...!! ya deja a esas ratas de basurero no valen la pena lo unico que corren es el osico. si puedes mandame un correo para escribirte o te mando el mio. Bueno saludame a los homeboys del jarudo y alas morras jarudas de corezon.AAHHH!!! y UNA RAYADA DE PUTA MADREEEE A TODOS LOS QUE CHINGAN CON EL JARUDO.

LA RITA ( e-mail: )
Jueves 05.05.2011 / 09:47

LA RITA ( e-mail: )
Jueves 05.05.2011 / 09:42

Jueves 05.05.2011 / 09:15

Jueves 05.05.2011 / 08:42

Jueves 05.05.2011 / 08:12

Jueves 05.05.2011 / 07:28

Jueves 05.05.2011 / 04:44

Jueves 05.05.2011 / 04:35

LA RITA ( e-mail: )
Jueves 05.05.2011 / 03:08

PRM ( e-mail: BORRACHOS )
Miércoles 04.05.2011 / 13:24
Ese video es mas biejo que tu P... madre y es jale de los z,ustedes se alucinan soñando despiertos. ya despierten ala realidad,lo unico que ustedes corren es el osicooo.

Miércoles 04.05.2011 / 13:19

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 10:32

tHe bAbY OnE ( e-mail: sOloS xv )
Miércoles 04.05.2011 / 10:23

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 10:19

msfk ( e-mail: )
Miércoles 04.05.2011 / 10:14

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 09:59

monii ( e-mail: )
Miércoles 04.05.2011 / 09:54
saludos a los del jarudo de aca del jarudo haciendas la monii.. saludos al nox,klen,nomy,gun,fiver,mi compita el sondo y el chato que los acabo de conocerr,skit,stik,tomate,yesk,a mi panchito que en paz descanze y a todas las jarudas,

Miércoles 04.05.2011 / 09:51

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 09:49

Miércoles 04.05.2011 / 09:24

juaritoz ( e-mail: )
Martes 03.05.2011 / 11:27
no se te quita lo idiota,pues como si naciste stupidooooo. ya despiertaaaa.

Martes 03.05.2011 / 10:10

Martes 03.05.2011 / 10:07

LA RITA ( e-mail: )
Martes 03.05.2011 / 07:45

PRM ( e-mail: MEXICANOS )
Martes 03.05.2011 / 07:30
la PRM apoyando al jarudo y un saludo a todos y todas los homeboys del jarudo y PRM borrachos. y felicidades por las morras que reprecentan su barrio especialmente a Rita. con respeto un PRM.

LA RITA ( e-mail: )
Martes 03.05.2011 / 07:03

PRM ( e-mail: borracho )
Martes 03.05.2011 / 06:22

LA RITA ( e-mail: )
Martes 03.05.2011 / 06:06
le mandoO un SaaLuDoo0 aaaL PITY,SKIT,NOX,TOMATTe...LoOs Quieroo tambn a toOdos los deL jarudoO aQii tiennen mi apoYoO PURO BJL AHUEBOO

la RITA ( e-mail: )
Martes 03.05.2011 / 04:02

JARUDOTEE ( e-mail: )
Lunes 02.05.2011 / 13:11
aquii estamos mis PRM puestotes siempre con ustedes para dar esquiina,, estos aztequillas no la arman carnal netha sin M... los del jarudo emos hecho de awua a dos tres de ahy

PRM ( e-mail: BORRACHOS )
Lunes 02.05.2011 / 12:55

RITA BJL ( e-mail: )
Lunes 02.05.2011 / 12:11

JARUDOTEE ( e-mail: )
Lunes 02.05.2011 / 12:01
callese wey los aztecas ni la rifan cana la netha los jarudo emos hecho de agua a dos tres que son aztecas P... no nomas porke andan tinteados piensen que la rifan putos,, no valen V... putos ya dejen de tirar tanta M... weyes agarren el rollo P... no sean mekos weii,,sengun ustedes hacen de awua al chapo y ke la V... si eso fuera ya lo hubieran tronado pero no lo hacen porke son culos,, ay un saludo a los PRM CARNAL aqui el jarudo y a dos tres carnalitos que estan en la torcida que son PRM tambn saludos carnales jarudolokos,,

Lunes 02.05.2011 / 11:03

mexico ( e-mail: )
Lunes 02.05.2011 / 10:45
ese video es bien pinche biejo,y es jale de los z, los putos linieros ni celular traen se alucinan viendo jales en TV y sueñan que son ellos.pero la realidad es que son culos solo roban stereos y viejitas inocentes.

PRM ( e-mail: MEXICANOS )
Lunes 02.05.2011 / 10:11

Lunes 02.05.2011 / 04:50

PBC ( e-mail: LOCOTES )
Lunes 02.05.2011 / 04:09

juarez ( e-mail: )
Lunes 02.05.2011 / 03:05

Domingo 01.05.2011 / 18:48

Jarudolokos ( e-mail: )
Domingo 01.05.2011 / 11:41
jarudo la rifa canas ya haganse a la costumbre de escuchar esoo,,

MSH 17 ( e-mail: )
Domingo 01.05.2011 / 11:23
pinches hea msf bjl pelones y tofos los barrios de juaritos son culos upura emesehere

mc trak ( e-mail: )
Sábado 30.04.2011 / 13:36

wFSOTeS ( e-mail: WORLD FIVE ONE )
Sábado 30.04.2011 / 12:49

JARUDOTE..!! ( e-mail: )
Sábado 30.04.2011 / 09:57

PRM ( e-mail: BORRACHOS )
Sábado 30.04.2011 / 09:52

PBC ( e-mail: LOCOTES )
Sábado 30.04.2011 / 08:11

jaja ( e-mail: )
Sábado 30.04.2011 / 04:15
eyeyeyeye k ese mentado solano k ese wey k nomas esta de mama huevos jejejeje es el muro del graffiti che peendejo ya cambia de pajina mi mama choras

sparki ( e-mail: )
Sábado 30.04.2011 / 03:42
guacha jarudo nosotros no sabemos quien corrio esa mamadora de que queremos pedos con ustedes jarudo y demonios siempre a estado firmes y aunque an caido algunos carnales estamos bien firmes y les brindamos respetos jarudo y dms 3 rip por el pancho era amigo de una de nuestra chompas el camote rip jarudo

solano ( e-mail: juaritoz )
Viernes 29.04.2011 / 12:33
tranquilo pariente,se te ba aderramar la bilis!! pues que no te muerdes la lengua cada ves que hablas? ademas nadie te cree tu valentia todos los que estamos en el muro nos reimos de todo lo que escribes.ya conocemos tu gente corriente.

SHAGYMAN ( e-mail: WFsOTeS )
Viernes 29.04.2011 / 12:22

solano ( e-mail: juaritoz )
Viernes 29.04.2011 / 11:43
eso si da risa,yo soy el que anda solo y la verdad los msf son puro chiste divertidos estos vatos. mas de una ves me los e topado y les e cantado un tiro y no amarran. porque me tienen miedo si soy solo? porque son culos y ocicones. ya lo tengo comprobadooooo.

Viernes 29.04.2011 / 11:28

HeAcK1 LoRsWaaN1 ( e-mail: )
Jueves 28.04.2011 / 20:04

JaRUDOTE..!! ( e-mail: )
Jueves 28.04.2011 / 18:39
vallance a la V... PBC a nosotros nos gusta estar entrados con todos los barrios porke traemos el power que ningun barrio trae todos no la pelan,, y para los del jarudo es un orgullo pertenecer al barrio putos,, nadiee nos tumba canas andemos solos o en manada siempre le salimos por eso nos conosemos y si te topamos solo te marraniamos porke asi somos no perdonamos a nadiee canas pa ke se calen JARUDOTELOKOS

el que anda solo ( e-mail: juarez )
Jueves 28.04.2011 / 11:27
no se te entendio nada,porfavor te molestes solo que tu mensj esta muy enrredado y confuso.gracias.

PBC LOCOTES ( e-mail: )
Jueves 28.04.2011 / 11:05

Jueves 28.04.2011 / 09:19
cual plaza controlan?? solo que el mercado donde sus hermanas compran verduraaaa!!! ustedes ya no tienen plaza o quieren mas yeleras?? puro PRM BORRACHOSSS y vengan por sus 2 camaradas o los ban a negar.

Jueves 28.04.2011 / 07:19

el kozZa ( e-mail: )
Jueves 28.04.2011 / 06:19
nomamen bola de P... aka puro kzv kanas pelan todos aka de eco 2000 rifando

sHAGyOneR* ( e-mail: wORlD FiVe One )
Jueves 28.04.2011 / 04:12

Jarudotess..!! ( e-mail: )
Jueves 28.04.2011 / 04:06
para que maman al antro jajajaja ese wey es de awua cana no la pelan putos,, JARUDOLOKOTESS..!!

eL LoRsWaaN1 ( e-mail: )
Miércoles 27.04.2011 / 20:10

nsl18 ( e-mail: )
Miércoles 27.04.2011 / 19:58
ponganse vergas todos los HEA pinches mocosos culos valen V... son como 50 y nadamas le salen el lors el antro todos los demas son chavalas mis repetos para ellos trucha pinches levas atte:NORTH SIDE 18

BJL ( e-mail: )
Miércoles 27.04.2011 / 16:31
arres mis PRM aqui estamos,, seguimos en contacto carnales aqui estamos para lo que serse ya se la saben,, somos gente y somos mexicanos orgullosamente..!! JARUDOTE

PRM ( e-mail: BORRACHOS )
Miércoles 27.04.2011 / 14:46
Como estan mis jarudos? aca en el centro del mapa todo bien. ya no hagan caso a esos chamaquillos que dicen puras tarugadas toda esa gente esta ardida porque saven que no la libran, ya ves dice el solano que los msf no le atoraron a un vato que anda solo!!!! esa gente solo corre el ocico. sobres pues... PURO SENTIMIENTO JARUDO PURO ORGULLO MEXICANOOOO...

sur side 13 ( e-mail: )
Miércoles 27.04.2011 / 13:06
q rollo jarudos que tan cierto es que andan de sicarios los de un barrio de ahy los LBP?? o es puro rollo ese o kee..!!

JARUDO ( e-mail: )
Miércoles 27.04.2011 / 11:53
que tranza weyes el jarudo sigue representando juaritoz putoss,, un saludo pa los PRM ahy estamos gentee..!! JARUDOLOKOS

j.l ( e-mail: )
Miércoles 27.04.2011 / 11:49
cabron con q me topo vieno estas pajinas pero lo q leo son puras M... por ninguno es sierto lo q dise por sur es el mas H... o sstk zaragosa

JARUDO ( e-mail: )
Miércoles 27.04.2011 / 11:35

( e-mail: )
Miércoles 27.04.2011 / 06:50
asi me gusta weyes k c callen el pincgi ocico cuando wachen k les dicen la neta C... jajajajaja y eso es poco de lo k les puedo segir diciendo cabrones jajajajajjajajaajajjajajaja

Jarudo..! ( e-mail: )
Miércoles 27.04.2011 / 05:43
wacha cana nosotros si sabemos quienes hicieron el barrio pendejo,, pero eso no es lo que importa wey lo que importa es que lo hicieron hace un H... o de años y nadie nos a tumbado P... como vez,, aqui seguimos puestotes cana, ahy barrios enteros wey de 20 o 30 weyes que tiran culon y prefieren hacerse del jarudo porke saben que si se entran con nosotros no la cuajan puto..!! no nomas hablen por hablar weyes al jarudo nadie lo va a tumbar nunka putos..!! JARUDOLOKOS..!

( e-mail: )
Miércoles 27.04.2011 / 03:15
yo k nisikiera soy de sus pinchis barrios se mas k ustedes pinchis mocosos son de leche todabia weyes a un barrio se le respeta cuando yevandola de perder no se rajan con los jarudos nos paso eso 2 ke 3 veses por eso les tengo respetillo pero eso fue muchos anos yo andaba con mi carnal y no sabia k royo pero ahora huacho k si le salian ...los msf no tenia k ser barrio se suponia k era un crew de grafiteros pero no salio asi.bueno eso es algo de lo k yo c

( e-mail: )
Miércoles 27.04.2011 / 02:49
jajajajajajajaja kien saco a los msf t apuesto k ni sikiera sabes bato y no soy del jarudo pa k sepas wey , y ni los chavillos del jarudo saben kien levanto su barrio,para tirar barrio deben de conocer kien lo iso y kienes lo levantaron no nomas tirarlo weyes

Jarudo..! ( e-mail: )
Martes 26.04.2011 / 17:22
simon PRM,, a estos weyes ahy que dejarlo que hablen no la arman tiran mucha mierda, son de esos weyes que nomas por aqui hablan y hablan,, al jarudo nos gustaq que nos demuestren con hechos putos sin nos van a tronar nomas haganlo y no digan tantas P... lo que vallan a hacer haganlo,, y acuerdense weyes los mas vergas caminan callados,,EL JARUDO SIEMPRE PUESTOTE

PRM ( e-mail: MEXICANO )
Martes 26.04.2011 / 13:57
fijense pues,los MSF dicen que ya tienen muchos años y no sirven para nada pinches coyones viciosos.y EL JARUDO apenas 3 años y ya traen H... o de respeto pues PORQUE SERAAA???? porque EL JARUDO LO DEMUESTRA y los msf SOLO CORREN EL OCICOOOO. ESTOY DEACUERDO CON EL VATO QUE ANDA SOLO LEEAN ESE MENSAJE AQUI ABAJO.

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 12:06
Kiieres apodos pues yo soi el kleens P... como la vez,, no mame wey el jarudo esta antes de que se hicieran tus pinchis ratoneras,,!! agarre el rollo wey nunka le emos corrido a los msf jaja si hace poquillo cuando fuimos con los pelones no salieron corriendo todos weyes,, son culotess,, no la arman putos es la netha cuando quieras caile y hazme correr como dices jajajajaja.!!

Martes 26.04.2011 / 11:06

( e-mail: )
Martes 26.04.2011 / 10:31

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 10:22
wacha cana pareceremos limosneros como tu dices, pero aun asi nos tiemblan todos los barrios en juarez wey, quiero verte decir eso en el barrio, te apuesto a que caminando no entras wey y sabes porke porke nomas hablas y hablas pero sabes que el jarudo la rifa y sabes que ninguno del jarudo se te hace para atras y si entras sales bailando a plomazos canaa, aqui hasta el mas morrillo si no trai cuete ya deperdida trae su hechiza pero le saltaa,, agarren el rollo weyes con el jarudo no pueden..!!

( e-mail: )
Martes 26.04.2011 / 10:09
jajajajajajaja simon parecen limosneriyos en el video en ves de asustar dan lastima jajajajajaja.... en una rola mensionan pelon toto y a otro..en donde kedo el pancho k no era el lider o algo asi,

( e-mail: )
Martes 26.04.2011 / 09:56
orale ese kienes son los k estan entrados con jarudo ponganse firmes vatos x k el jarudo sigue en el juego simon k si la BJL desmadra k no!!!! arre putos salganle

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 07:22
GraciAS mis PRM aqui tambiien los respetamos, son gente que le sale por el color de su bandera mexicana y eso es de respeto nunka olvidar cuales son tus raices..!! PRM para lo quenecesiiten ahy estamos,,BJL

PRM ( e-mail: MEXICANOS )
Martes 26.04.2011 / 07:14

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 07:12
NA carnal a nosotros no nos afecta lo que piensen los demas barrios,,puede que el del video que dices se vea perilla pero caigale al barrio wei y ahy mushos que se ven mekones o fresas pero no les tiembla para darte en la madre y eso es lo ke importa carnal,, chida lokos del jarudotee..!!

( e-mail: )
Martes 26.04.2011 / 06:55
ey jarudos diganle al gun k no suba fotos de mocosos gordos k no son maliyas del barrio,la neta pura kemason suban fotos de ustedes ,el gun sube fotos bien cagadas neta cualkier kabron se rie de los videos estan bien culerotas y todos piensan k asi son todos los jarudos jajajajaja

juarez ( e-mail: )
Martes 26.04.2011 / 06:48
esos MSF son bien coyones,solo tienen ocico para ladrar no atoran ya los e checado y valen madre, soy solo no ando con nadie y ningun P... de los disque MSF me asusta son bien culones. esos P... son de agua ya los e checado.

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 06:23
aqui el jarudoo,, como siiempre levantando banderaa..!! la seguiremos rifando entre los barrios locales le pese a quien le pese weyes,, somos la pandilla que la rifa y son tener ningun paro solitos los hacemos de awua a todos..!! jarudolokoss

( e-mail: )
Martes 26.04.2011 / 04:56
pinchis demonioas como k son 2A pues no k solos pueden pinchis chaketas !!!!aki puro de juaritos .la _____________ controla x k somos locales

( e-mail: )
Martes 26.04.2011 / 04:26
como se yama el rapero del jarudo..le dicen el gun pero cual es el nombre

( e-mail: )
Martes 26.04.2011 / 03:51
ese P... d la msf m da risa no sabe ni kien invento ese crew pobre P... y dice k msf for life jajajaja ... son de agua chavalas!!!!! apenas tienen unos 8 anos k c invento y dice k ya controlan juarez jajajajaaja...todabia tienen k pasar x mucho apenas empiezan el jarudo tiene como 18 anos como barrio eso ya marca y se siguen levantando

JARUDO ( e-mail: )
Lunes 25.04.2011 / 19:23
arres demonios amarrence weyes ya saben todos los pinchis barrios locales de juarez quienes son los del jarudo putos,, por algo no emos ganado el respeto porque mi gente no se raja desde el mas morrillo hasta el mas ruko sigue levantando la bandera,, y usted callese pinchi mokoso los msf no la pelan wey y usted sabe bien weii no la caliente cana ya sabe como corre el agua aqui, y si wey te entiendo la PRM no les dice a ustedes que los respeta porke saben que no valen vergaa en cambio los del jarudo nos ganamos el respeto de ellos por ke saben que en un paro el que sea le salimos..!! ahy estamos y los demonios de rato les caemos weyes..!! JARUDOTE LOKOSS..!!

( e-mail: )
Lunes 25.04.2011 / 17:07

Lunes 25.04.2011 / 10:17

Lunes 25.04.2011 / 10:11

( e-mail: )
Lunes 25.04.2011 / 10:07

( e-mail: )
Lunes 25.04.2011 / 09:53
ese wei de los dms pinchi chavala deseguro as de ser un pinche mokoso pendejo,alcontrario pinchi P... t deveria de aguitar k kiebren a los jarudos de seguro ni conoces al pancho preguntale a un veterano de tu P... barrio pa k conoscas un poco de los jarudos wey

123 ( e-mail: 123 )
Lunes 25.04.2011 / 05:49

Lunes 25.04.2011 / 03:27
saludos alas mamas de todos los P... k escriben en esta M... ya maduren compas pongase a hacer algo util se cren la gran V... escribiendo sus M... ponganse a pensar 5 minutos nomas k la neta estan bien P... perdiendo el tiempo en esta M... no les digo k no agarense a madrasos pero aganlo no nomas con sus hay te voy a matar hay no yo primero,hay dame mis munecas y toma tus canicas pongase las pilas pinches chabalas vien vergas por aqui se cren hijos del chapo y ala mera hora bien culones si van a hacer su desmadre aganlo y no tiren tanta M... por aqui se van a matar matense pero aganlo putos no nomas digan y no digan tantas M... los que se cren mafiosos si de verdad fueran no estarian aqui con sus M... ponganse a pensar esto 5 minutos y es la neta agren el rollo y como les digo si van a hacer su desmadre aganlo pero no sean P... y se pongan aqui a escribir sus M... bueno H... en asu madre y ya maduren putadas!!!!!!!!!!!

DYNER.DMS3 ( e-mail: )
Sábado 23.04.2011 / 18:09
Q tranza mis jarudos culos, como le va al dosil y al koala en el cielo jajajajajajajajaja apoco pensaban que la rifaban mekos jaja, y ke apoco piensan que con mamar a los prm la van a cuajar pendejos, tambien ese wey que no mame deseguro es un pinchi lepe y anda mamando que es prm, no caguen la V... mekos saben que los AA son los que la rifan mekos... DEMONIOTES TRESS..!!AA

jarudo ( e-mail: )
Sábado 23.04.2011 / 15:56
ese wei,, jajaja no sea P... weii mejor callese si no sabe como esta el rollo para empezar al pancho ya lo tronaron y si no sabes por que pedos fueron mejor no hable pinchi mokoso meko.!!

xtrenger ( e-mail: )
Sábado 23.04.2011 / 13:43
para kien trabajaba el pancho,sin incluir al barrio x uno no la van a yevar todos nomas pa k sepan

JARUDO ( e-mail: )
Viernes 22.04.2011 / 09:44
si aztekiita de mierda,, ha nosotros demuestranos con hechos wey,, cualquiera puede tronar un cuete wey,,aqui en el jarudo tenemos la variedad meko no creas que son los unicos que tienes calibres grandes aqui tambn tenemos arsenal para darles en la madre a quienes se metan con nosotros pendejoo,,!! y no pedimos chichi wey simpplemente la PRM no son culos como ustedes y se ganan el respetoo

aztecotas ( e-mail: cocha )
Viernes 22.04.2011 / 08:32
mira pinche jarudo hijo de perra tu y los mexicles vayanse ala V... me los paso por los huevos y no pedimos chichi a nadie perro bendido y prm tu no tienes a nadie de mi gente camellando con tigo mamon y el langaro k dise k nadamas kedan gabachos estas P... estamos en juarez rifando como siempre porke los aztecotas siempre ban a estar para darles V... cuando kieran o pidan mis putitas dea free pinches pirujas y metanselo en la cabeza oen el C... k aztecas sienpre va a rifar putitas

PRM ( e-mail: MEXICANOS )
Viernes 22.04.2011 / 05:48

JARUDO ( e-mail: )
Viernes 22.04.2011 / 04:51
el jarudo no trabaja con nadie carnal pero respetamos a la PRM y tiienen esquina de nosotros,, y ese wey que dice que no salimos ni a la eskina que no mame que se tumbe su rollo meko no por ke te creas azteca P... pienses que nos vas ha hacer de awuaa,,aqui tampoco nos tiembla tronarte el cuete en la chompa wey,,aztequillas culos conocemos dos que tres de tu gente wey que nomas por andar rayados piensas que la arman y no son nada,, agarre el rollo wey..b-jarudolokoss..!

( e-mail: )
Viernes 22.04.2011 / 03:38
PRM es una familia o mafia y los carnales son los que operan en esta organisacion los que ya conocen el contenido de PRM se nombran carnales o hermanos y de quien manda en el JARUDO pues yo pienso que EL MISMO JARUDO pues es su barrio y alo que yo se el JARUDO NO TRABAJA PARA NADIE. espero que esto responda tus preguntas y YA NO ANDES DE CURIOSO PORQUE ESTA CABRON.

( e-mail: )
Jueves 21.04.2011 / 17:10

( e-mail: )
Jueves 21.04.2011 / 16:55

Jueves 21.04.2011 / 16:51

xtrenger ( e-mail: )
Jueves 21.04.2011 / 16:47
para kien trabanjan los jarudos?

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 14:47

clavo ( e-mail: )
Jueves 21.04.2011 / 14:38
creen que con marranearse con la jente de juaritos nos van a enconchar y nel carnal x que nos asen mas fuertes x que estos vatos son gabachos disfrasados pero como hay dos tres guecos sel entra el rollo de estos marrananoiy quioeren pelear en contra de nosotros pero revisen guecos prm pura raza mexicana atecas 2 barrioo lideres gabachos chompas gabachas que son guecos mecos piloteados x gabachos para agarrar poder en mexico pero se la van a pelar pero todavia hay jente que piensa y analisa la istori dse estos marranos y commo cammeellan

clavo ( e-mail: )
Jueves 21.04.2011 / 14:27
que transa carnal saludos y respetos al rato le ago llegar mi directa saludos para los jarudos y para todos los afiliados mire carnal estos pinches aztequitas que quedan no valen V... son unos chicanillos que se an querido meter a juarez buscando banderas de aqui pero son gabachos por eso buscaron afiliarse con los linieros para agarrar una bandera de juaritos pero estos batos la estan cagando x que quieren apoderarse dejuarez x medio de esa bandera pero se la estan pelando espero y los linieros agaren el rolllo atiempo x que estos vatos son unos tridores a su vandera y saben que no la pelan x eso le fueron a pedir chiche a los linieros x que sabian que la jente lla se etaban dando color de sus panes pero estos vatos siempre traisionan y terninaran x trisionar a sus chompas aora los linieros como ls isieron con pelucar chuy el diablo chacu y los de adeveras estos son vendidos que los proteje el fbi x pasarles informacion x medio de su chompa el chino pero piensan que con marranearse c

PEKADOR ( e-mail: )
Jueves 21.04.2011 / 12:11

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 08:34
Si mis JARUDOS ya se les explico a estos vatos pero no pueden en tender.EL JARUDO ES BARRIO PERO DE LEY Y TIENEN SU RESPETO BIEN GANADO. LA PRM ES FAMA Y DA LA MANO A QUIEN LA QUIERA Y NECESITE. a estos cabrones les duele que nos demos squina pues que esperaban.somos raza y nos paramos por nuestro respeto. esta gente ya se siente devil por eso le arde quedarse sola pero eso les pasa por ojetes. puro PRM y JARUDOS REPRECENTANDOOOOO.

BJL ( e-mail: )
Jueves 21.04.2011 / 07:32
arres PRM aqui el jarudo tambien les da esquina,,.. JARUDOLOKOS...!!!

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 04:52

Jueves 21.04.2011 / 04:46

aztecas ( e-mail: silbestre )
Miércoles 20.04.2011 / 17:12
aprendr a escribir y apoco tu tienes patria o bandera invesil.perro nunca an valido V... saves bien estupido todos ustedes me le pelan pinches verijones de M... y jarudo si es 1 barrio para que estan mamando ala pinche prm son unos P... no mamen a nadie ni respeten para k le dan esquina no k muy vergas los weyes dejenlos muy meniados ponganse a bender bonais para k ganen mas pork si sigen asi ban a pedir limosna como sus mamas las taraumaras y ya se la saben aztecas rifa en juarez y donde sea y el prm k dise k esta enmedio de mis bolas ben aca si te las das de muy vergas hijos de perra asta berguensa me da peliar con ustedes basuras

PRM ( e-mail: BORRACHOS )
Miércoles 20.04.2011 / 12:47

aztecas ( e-mail: silbestre )
Miércoles 20.04.2011 / 10:53
vayan a C... a su perra piruja madre de la mariscal apoco muy vergas C...

JARUDO ( e-mail: )
Lunes 18.04.2011 / 07:17

el kyfesillo0 ( e-mail: )
Domingo 17.04.2011 / 19:34
heii heii aky andamos pinche bola de culos saven bn que los de la seventen se los cosha pa que andan kon M... puro msh becede south side lockos pinche bola te P... puro msh diecisiethotha lockototes ya se la saven puro msh 17 el kyfesillo de la seventen lockos putos son los que rifan todo el granjero C... y mas alla de el granjero by the kyfesillo0 de los msh becede THE AMO ALEJANDRA ERES MY TODO MY AMOR

( e-mail: Jlokottes )
Domingo 17.04.2011 / 13:07

culos ( e-mail: )
Sábado 16.04.2011 / 16:59
nada cularos

culos ( e-mail: )
Sábado 16.04.2011 / 06:56
H... a tu madre prm de M... muy vergas pinche basura son culos de amadre wey me pelan la V... tiran mucho royo toda tu pinche gente bueno sies k tienes pinche perro bendido hijo de toda tu re perrisima madre de M... k tienes y al pinche jarudo de M... y wf tambien pinches cacas del diablo me la pelan

SHAGYONER ( e-mail: B'WFsOTeS 1 )
Jueves 14.04.2011 / 11:54

2AC ( e-mail: MOST'ER )
Jueves 14.04.2011 / 11:45

Miércoles 13.04.2011 / 21:08
lla esta ablado mis PRM´´ ustedes igual ai estamos para lo q se ofresca y esos abladores lla no pierdan su tiempo en pendegadas ai q ser derechoos ..JARDUO ES BARRIO .ai estamos para la esquina `PRM ..JARUDO TAMBIEN SE LA estamso en contacto todo para delante pura jent de huebos

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 13:10
me da gusto conocer gente como EL JARUDO q le sale al toro y son derechos. y duro con esos putos q solo hablan M... son puros ardidos y poquiteros. cuando EL JARUDO NECESITE PARO AHI VA ESTAR LA PRM LISTOS PARA TIRAR SQUINA.

jarudo ( e-mail: jarudo )
Miércoles 13.04.2011 / 11:15
lla esta mis PRM ai estamos el resperto esta gandado x q ablan con seriedad y bien derechotes ustedes sigan en su jale zero broncas entre JARDUO Y LOS PRM.USTEDES RESPETO NOS DAN Y DENOSOTROS RESPETO RESIBEN .y no ai q degar q metan rollo entre nosotros ai estamos pues PRM ..JARUDOLOKOS

PRM ( e-mail: BORRACHOS )
Miércoles 13.04.2011 / 09:52
oye vato BTP,no se de que hablas.pienso q estas confundido checa bien los mensjs ya q solo le tiro rollo al jarudo y mis respetos para ellos. y si algo te ofendio a ti directamente pues estoy a tus ordenes. la PRM.

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 09:43
Claro carnal y si usted puede mandeme su correo. y todo tranquilo terminando mi almhoada de plumas de guajolota ya casi la termino. y para que no sufran tanto puro PRM. o quieren otra caja como la del lunes?

clavo ( e-mail: )
Miércoles 13.04.2011 / 06:48
saludos para el borracho que carnal aqui estoy quemando sinta lellendo como se tira con las trensudas y con los linieros pero no vale la pena estos vendepatrias no son nada lla les llevamos mucha ventaja lla la jente esta asta la V... de ellos x ratas x C... alos paisas con sus putas cuotaslla estamos areglando eso x eso emos llenado muchas fosas y quemado muchos marranos uste sabe la basura se resicla lla los estoy usando de fertilizante en mi ranchito para que sirvan de algo toda esta basura y al P... liniero que gasta lineas mejor corre como toda tu jente para villa umada que te agarro o te uvico y te boy a comeri vivo alcabos lajente de villa ahumada no resibe basura y en poco tiempo no tendran donde esconderse y aqui con unos de tus amigos que tengo aqui me boy a tom amar a presente ytus palabras en estos dias te mando mi respuestya pura raza mexicana 3 lineas menos jjaaaaaaaaaaa

CHAVEÑOTA ( e-mail: BTP1 )
Miércoles 13.04.2011 / 05:31

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 04:16
Sobres pues jarudos,todo tranquilo con nosotros.echenle ganas y animo alsando esa bandera. me da gusto ver que aclaraste ese detalle habla muy bien de ustedes. con respeto la "PRM".

MOST ( e-mail: 2AC )
Miércoles 13.04.2011 / 03:33

bjl ( e-mail: jarudo )
Martes 12.04.2011 / 22:07
q rollo PRM guachense no degen q les metan rollo nosotros somos del jarudo y eso welles q estan escribiendo q qeremos ser PRM .es puro rollo nosotro nos no metemos en eso rollos de mafias nosotros no tenemos broncas con ustedes y nosotros no jalamos para nadie aqi nomas es barrio .y ai algien q se esta asiendo pasar por nosotros megor ai q taloniar a ese wei y ai q acerle un desmade por ablador tamos pues miS PRM..jarudo lokos

( e-mail: JARUDOTE! )
Martes 12.04.2011 / 20:22
no se anden con P... ijos de toda su pinchi madre jarudo no trabaja para nadie los del jarudo tenemos huevos i muchos ijos de P... porqe los emos tenido para mandar ala V... a doblados o a linieros asi qe H... en asu P... madre eso no lo an escrito jarudos lo an escrito los mismos P... ! con nosotros no podran

PRM ( e-mail: BORRACHOS )
Martes 12.04.2011 / 16:07

meseehere ( e-mail: )
Martes 12.04.2011 / 15:29
lokotes diesiciete sigue rifando aki con mi mando uno siete siempre respetado pork al mirarme t kdas siete siempre representando putitas m s h s u r

msh diesiciete ( e-mail: )
Martes 12.04.2011 / 15:25
no mamen pinches mocosos ya no saben ni k poner pinches barrios kks k cuete si ni tienen en k kaerc muertos no mamen ay tamos diesiciete pa delante y nada pa tras culitos mios meseehere gravencelo south side

PRM ( e-mail: BORRACHOS )
Martes 12.04.2011 / 13:22
Jarudo, ya tira al lion a estos P... y dime que onda con los mails que te mande porque ya te mande 2. todos estos pinches poquiteros asi son, y cuando ven el cuete se cagan. ANIMO GENTE TODO MACHIN.

( e-mail: )
Martes 12.04.2011 / 11:59

AAc ( e-mail: 2Ac PRADERAS )
Martes 12.04.2011 / 10:31

PRM ( e-mail: BORRACHO )
Martes 12.04.2011 / 08:19
Que pues jarudo,ya mande 2 correos en los dos mails q me mandaste y aun NO recibo respuesta. Que onda??????

JARUDOLOKOS ( e-mail: )
Lunes 11.04.2011 / 17:16
ni sabes que rollo con el jarudo wey no seas P... cual que estamos con la linea,, no cague la V... y metase en sus pinchis rollos wey..!! no hable por nosotros cana keremos representar PRM y no te tenemos por ke dar explicaciones del porque pendejo

Lunes 11.04.2011 / 12:57
MIra baboso,cuando la "PRM"comenso a ganar plaza la unica linea q avia era la q dejaban los putos como tu cuando los llevabamos arrastrando.el ardor q tu tienes esque no tienes bandera eres un P... sin patria. y si el jarudo camella para los azcacas o para cualquier P... d ustedes entonces dime porque quieren reprecentar PRM? yo te lo dire, porque SOMOS MAS CHINGONES QUE CUALQUIER PUTA LINEAAA.

VIVA JUAREZ WEIII ( e-mail: juaritos )
Lunes 11.04.2011 / 08:01
ese wei que representa diske al jarudo mejor no se meta en eso royos cana por que todos en juarez saben que el jarudo le camellan alos carnales.... y ese wei de la prm aki ke H... ados bienes aser si dises ke estas en el centro de MEXICO ni sabes que pedo aki en juaritos nomas la andas cagando as de ser un pinche mokso caga V... io tabn pero yo si se como corre el agua kn la gente aliniada y mejor no tires tu royo ni ese wei ke dise ser del jarudoo el jarudo es gente aztecas wei inche mokosiyo caca y saludeme ami carnal el duda,klen,y al scor de las aka de las AZTEKAS DEL MOLINO 13...........

Domingo 10.04.2011 / 18:29

JARUDOLOKOS ( e-mail: )
Sábado 09.04.2011 / 08:55

PRM ( e-mail: BORRACHO )
Sábado 09.04.2011 / 06:33
Que pues jarudo, no has contestado mi correo.lo recibiste o no?

JARUDOLOKOS ( e-mail: )
Sábado 09.04.2011 / 02:26
aqui el jarudo, carnales de la PRM aqui les dejo otro msn este carnal tambn es del jarudoo

PRM ( e-mail: BORRACHOS )
Viernes 08.04.2011 / 16:01
si usted reprecenta algo hagalo con respeto y no como pendejo. digame que trae contra la "PRM" y te ACEGURO que lo harreglamos. pero no abras el ocico alopendejo. estamos a tus ordenes. PRM.

shagy ( e-mail: )
Viernes 08.04.2011 / 14:51
kinto mundo hijos de perra el shay wf1 en el refuego machin perros

shagy ( e-mail: )
Viernes 08.04.2011 / 14:48
pues bamonos resio C... apoco k piensan k la ban a cuajar escrementos de chiva world five one de tierra nueva 1 shagi

123 ( e-mail: 123 )
Viernes 08.04.2011 / 11:22
saludddddddddd carnal

PRM ( e-mail: BORRACHO )
Viernes 08.04.2011 / 09:20

JARUDOLOKOS ( e-mail: )
Viernes 08.04.2011 / 08:54!! ahy estamos carnal jarudolokos dando apoyo..!!!

PRM ( e-mail: BORRACHO )
Viernes 08.04.2011 / 08:33
Que pues mi 123, me da mucho gusto del carnal q salio d la torcida ahi q alivianarlo en lo pocible y gracias por estar al pendiente del borracho. y q pedo con este microbio q esta faltando al respeto si usted lo colorea para q se contacte conmigo y arreglar el asunto. digame,usted tiene correo electronico?

PRM ( e-mail: BORRACHOS )
Viernes 08.04.2011 / 08:17
Que pues mis jarudos reportense mandenme su correo electronico para tirar rollo y chequen mi mensj anterior.

123 ( e-mail: 123 )
Viernes 08.04.2011 / 04:45

shagy ( e-mail: )
Jueves 07.04.2011 / 14:55
ke transa weyes tumbense el pinche royo P... ya me tienen asta la V... tiran mucha labia me la pelan barrio world five one doble u efe de tierra nueva 1 perrossssssssssss

PRM ( e-mail: BORRACHO )
Jueves 07.04.2011 / 11:13
ninguno d ustedes tiene correo electronico? porque si es necesario platicar.yo estoy en el centro del mapa pero puedo darles mi correo.

JARUDOLOKOS ( e-mail: )
Jueves 07.04.2011 / 09:03

123 ( e-mail: 123 )
Jueves 07.04.2011 / 05:16

PRM ( e-mail: BORRACHO )
Miércoles 06.04.2011 / 07:33
Jarudo,si tienes correo mandamelo o tu dime como tiramos rollo. o yo te mando mi correo. estamos puestos. y al 123 "PRM" COMUNICATE CONMIGO LO MAS PRONTO PICIBLE.

123 ( e-mail: 123 )
Miércoles 06.04.2011 / 06:09
ya estan jarudo yo te buscare yo los tengo hubicados para estar en tregua y no se aguiten a la 123 PRM

barrio wf1 ( e-mail: de tierra nueva 1 )
Martes 05.04.2011 / 18:23
k roio k roio dloble u efe uno de tierra nueva shagy

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 13:47

PRM ( e-mail: BORRACHOS )
Martes 05.04.2011 / 12:45
Simon Homeboy, digame usted colorea a un borracho que traiga raya? necesito contactar algun PRM para darles la botella a ustedes. necesito que me diga como tirar rollo mas seguro. animo gente.

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 11:43
simon carnal y no nos awitamos por la gente que nos tronaron,, ya supimos como estuvo el rollo..!!

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 11:38

PRM ( e-mail: BORRACHOS )
Lunes 04.04.2011 / 11:21
Que pues mis jarudos un saludote a toda la raza firme. ya tranquilos con los calacas fue una equivocacion y todo esta machin.animo gente y gracias por reprecentar y apollar ala "PRM".

calaverotas 15 ( e-mail: )
Lunes 04.04.2011 / 07:06
sobres tire al leon

123 ( e-mail: 123 )
Lunes 04.04.2011 / 05:31

123 ( e-mail: 123 )
Lunes 04.04.2011 / 05:27

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 19:23
e cana ya bien que significa prm

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 18:30
Sobres pues. mi jale es con los putos linieros y toda esa chusma de nacos sin patria ni bandera. con respeto PRM.

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 17:56
nada pero tu empesaste a desirme cosas mejor tirame al leon pues pero no mucho rollo

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 16:46

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 16:33
ni tu gente vale V... C... ala V... prm i no soy de la linea weyonsote

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 16:33

jarudolokos ( e-mail: )
Domingo 03.04.2011 / 15:44
cual pinchi linia cana el jarudo apoyando siempre a la PRM siiempre esperando cualquier orden putos la linea no vale V... son culos todos

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 13:42
como te disen el mama vergas me la pelas prm k significa puras rameras mama fierro C... tu madre y no soy azteca ni de la linea perro

PRM ( e-mail: BORRACHO )
Domingo 03.04.2011 / 11:55

col ( e-mail: )
Domingo 03.04.2011 / 10:52
el cdg va por los ondeados de juares perros desde tamaulipas

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 10:31
come caca tamaulipas y lupe de mierda

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 10:25
vete ala V... C... tu y villa ahumada muy movido hijo de perra come M... puras cvs 15 west side el bebe te cocha puto

lupe ( e-mail: )
Domingo 03.04.2011 / 10:20
c d mier tamaulipas cdg y zetaz sedan con todo frontera caliente

( e-mail: )
Domingo 03.04.2011 / 08:02
este pinche de la PRM ke as de ser un pinche mokoso kaka ke nomas anda cagando la riata netha aki en juarez puro pinche aliniado....y este wei de los calacas mejor callese pinche lomero de M... pura gente de villa ahumada pendejosss

calaverotas 15 ( e-mail: )
Sábado 02.04.2011 / 08:28
controlando cvs 15

calaverotas 15 ( e-mail: )
Sábado 02.04.2011 / 08:23
H... en a su madre putos calacotas 15 los cocha pinches come tacos hijos de su P... madre los voy a cochar ponganse vergas cacas

PRM ( e-mail: BORRACHOS )
Sábado 02.04.2011 / 05:17

villa humada ( e-mail: ________ )
Sábado 02.04.2011 / 05:03
pinches prm mmmmmmm ke tranza gente aliiada aka desde villa humada kn a jente del j1 rifando todo chihuahua y saven bien ke le ______ nunka va amorir C... pinchs montaperros ijos de la riata puro pinche comando emenems culerosss villa humada rifaaaa juarezz ________ linieros asta la muerte pura jente pesada h3 j1 R8 y mi cmpadre chaloo

JARUDOLOKOS ( e-mail: )
Sábado 02.04.2011 / 04:47

SHAGYONER***** ( e-mail: DOBLE U EFE UNO )
Jueves 31.03.2011 / 19:16

jorge ( e-mail: )
Jueves 31.03.2011 / 11:14
y porque tanto coraje con la prm?

juan ( e-mail: .................. )
Jueves 31.03.2011 / 10:50
los putos dpc rifando y controlando en cualkier parte putos la linea y la prm me la pelan

PRM ( e-mail: BORRACHO )
Martes 29.03.2011 / 07:54

123 ( e-mail: 123 )
Martes 29.03.2011 / 05:42

rene ( e-mail: )
Martes 29.03.2011 / 05:09
pues ami me gustaria apoollar alos de la prm ellos si son mexicanos y no mugrosos y rateros como los de la linea.

pendegos ( e-mail: )
Lunes 28.03.2011 / 17:37
ai cabron no mamen pinshis narcos estan cabrones ..cuando abian bisto un sibernarco jaja nomas en cdjuarez aunq estos no son narcos por q los berdaderon narcos no andan con estas pendegaditas de q llo soi poderoso y nono llo mas jaja pinshis tontos por eso estamos como estamos ojala y maten a todos esos dicke narcos ..y llo le boi a la linea x q soi de cd juarez .y por ellos aqui ai dinero

( e-mail: )
Domingo 27.03.2011 / 17:09

PRM ( e-mail: )
Domingo 27.03.2011 / 10:13

linea ( e-mail: LINCES..AZTECAS )
Sábado 26.03.2011 / 22:04
aber ai q poner orden aqi lla ai q degarles bien en claro kien la tiene mas grande la linea. un cartel berdadero no pendegaditas como las d ustedes y llo no beo q borren lineas jaja llo cadabes be mas lineas y linces x todos los lados ..megor llla degan de matar jent inoosents y degen trabagar a la cd en paz lla o pidan cuotas ..pinshis muertos de ambre jaj a la linea lo q le sobra es feri en cd juares el sielo sige verde y sigen callendo los culos de los 2a y prmierda..y sus federales cada bes mas niñas se sigen viniendo con nosotros x q aca ai mas feriia en el cereso sige siendo el pawer de nosotros como en todos lados carrtel de carrteles la linea comandos linses sicarios malditos aztecas alcones dondeqiera si8cariso con placa munisipales y toda las corporasiones ..atte la linea y si qieren mas jales para ustedes nomas siganle de osocones putos

Viernes 25.03.2011 / 11:12

( e-mail: )
Viernes 25.03.2011 / 10:21

mauri ( e-mail: bbp )
Viernes 25.03.2011 / 09:53
chin.gen pro chin.gen a toda su madre esoso weyes de la prm para empesar pinchi vato C... no pone ni kien es k we tienes miedo k te maten mi nena jejeje ches vatos mierdas toda la bola de weyes ban a cAER CUAL ES EL PINCHE PEDO SI YA C LA SABEN K ANDAN CAGANDO LA BERGA ANIMO PINCHES VERIJAS MIONAS

osteer ( e-mail: )
Jueves 24.03.2011 / 16:53
dc de oster

PRM ( e-mail: BORRACHOS )
Miércoles 23.03.2011 / 17:21

( e-mail: )
Miércoles 23.03.2011 / 10:05

( e-mail: )
Miércoles 23.03.2011 / 09:43
qe transa pinxiz marikones de las aztekas aki viendo las P... qe dizen i para dezirles qe eskriben puras MAAAMAADAASSSSS!!!!!!!!!!!!!!!!! PENDEEEEEEEJOOOOOSSSSSSSSSS PURA PINXI LINEOTA RIFAMOZ Y KONTROLAMOZ LAS KALLES DE MY JUARITOZZZZZZZZZ PUTOZ!!!!!!!

PRM ( e-mail: BORRACHO )
Sábado 19.03.2011 / 15:55

clavo ( e-mail: )
Sábado 19.03.2011 / 12:05
saludos carnal de los borrachos de la frontera aqui andamos en la ranfla patrullando seguimos borrando lineas y destrosando emplumados me da gusto y no nos aga de agua que las pollas son para los carnales de la torcida los leones de la calles tambien queremos ver ese ganado que no aqui tambien traemos morras buenas y de guebos nadamas abisen cuando bajan y asemos fiesta hay me saludan al los senores y que miren el cromado hay cada 2 3 dias les estamos mandando todos sus monos atte el grupo 12

towi ( e-mail: )
Sábado 19.03.2011 / 11:55
mis respetos para mis carnalitos del prm en especial para mis carnales en el cereso estatal y en el municipal hay saludos de sus carnales de durango andamos arrasando pues aqui estamos rodeodos de chavalonas nadamas vajamos a la frontera y les bamos a llevar carne nueva alistense mis leones jajajaa

Martes 15.03.2011 / 11:11

LOS TERRENOTES 13 ( e-mail: )
Martes 15.03.2011 / 04:38

sHAgYOneR'' ( e-mail: w five unO wf1 )
Lunes 14.03.2011 / 09:45

( e-mail: )
Lunes 14.03.2011 / 04:45

emo0 ( e-mail: )
Sábado 12.03.2011 / 16:55
eiii ia kiero0 k se arm o0tra pela d emo0s en estha ciudad co0nthra lo0s pinchis punketho0s o lo0s darketo0s pro0 esta vez k sea en plaza la to0rres si no0 se arma pinchis culo0s enserio0

.I, ( e-mail: )
Sábado 12.03.2011 / 11:46

PRM ( e-mail: BORRACHO )
Sábado 12.03.2011 / 09:24
Pues yo soy PRM y ustedes siempre me an dado lastima,en la pricion en Texas ustedes lo unico q corren es el ocico. dan lastima ya aceptenlo YA PERDIERON LA PLAZA. y sabes porque? pues por P... y pasados d madre con la misma gente.por eso y mucho mas.... puro PRM.

brower ( e-mail: )
Sábado 12.03.2011 / 08:23
guache ese P... que le esta tirando a los aztecas nos pelas la V... no sabes nada de control nosotros controlamos todo lla tenemos juarez y nos la siguen pelando y a todos esos que se asen llamar paisas aqui en el chuco nos los estamos cochando atte el brower el paso texas rifa marrano

solos xv ( e-mail: bebeoner )
Sábado 12.03.2011 / 05:25
inches ks jajajajaja son re culos nomas son como 6 weyes y es me jor ke no tiren su kaka por ke van avaler V... si siguen cagando la riata van avaler V... ijos de la V... y diganle al punche smock ke ya sabems donde cantonea q no sigan cagando la riata putos !!!!!!!! solosxv controols haciendas

jarudolokos ( e-mail: bjlkz )
Viernes 11.03.2011 / 18:25
jaja x q seran tan mentirosos los msf de M... ..jaja tu apenas andas con esos rollos de los ebentos jajaja no mmes eso q we jaja qien shingaos ba a qerer ir a esas M... .ya tubec el rollo a rapero ahaa en el maika ahah bin cagadote a mc..jajaja nadiee t conose we xq estan bien pedorotes...bueno y lla dega d mentir tiren el rollo de malandrotes xq no son son puro culon..condominieros culones jaja a multifamilaiarez daria vergunsa desir q vivo ai la pelan la V... todos los entrados ..y los ks q qieren fama ..jaja tumbence ec rollo ustedes estan mas cagados q estos pendegos oo mas parese inposible pero no lo es x q alabaraba son un par de barrio de shabalas q dan riisa ...jaja .bueno BARRIO JARUDO LOKOS COCHA PUTOS

( e-mail: )
Viernes 11.03.2011 / 12:21

DRAW MSF ( e-mail: la cuesta lokos rifa msf )
Viernes 11.03.2011 / 10:18
ya saben pinches bjl de M... saben bien k no la pelan P... di algo k sea verdad wey no mamadaz y para la otra ustedez weyes tiren adar segun train pistolas de agua y ni asi putos tienen miedo de caer alas grandes P... igual k los k.s de M... saben bn k no la pelan por k en los condo la msf rifa putos como ven me tiraz tus rimas cagadaz wey y estan bn pendejaz la netha tirame en el micro wey este domingo k biene como vez y ya saben ala V... con todoz los entrados de M... ......saben quien es la V... el draw de la cuesta lokos rifa for ever y me vale madre todos los entradoz como ven el draw ya se la saben caiganle cuando quieran para darles piso por k con solo doz putasos al suelo van adar y jarudoz hay pary en su barrio y lez voy a kaer hoy viernes con mi pipo como ven unos de achole o k

( e-mail: )
Miércoles 09.03.2011 / 12:14
los msf y acg son unos pobres mugrosos ridiculos, ya tumbense ese rollo CAGADO que traen,y si van a sacar sus pistolitas tiren a dar y no al cielo porfavor jajajaja

( e-mail: )
Miércoles 09.03.2011 / 11:40

pEkAdOr de LA K.S ( e-mail: )
Martes 08.03.2011 / 18:58

dobleuefeuno ( e-mail: )
Martes 08.03.2011 / 08:15
la klica de la ke tienen ke hablar sienpre se la han rifado sin pedirle chichi a nadie wf1 tierra nueva

world five OneS ( e-mail: wf1 de tierra nueva )
Martes 08.03.2011 / 04:50

jarudolokos ( e-mail: )
Domingo 06.03.2011 / 18:29
jajaja q train los msfetos..pobres pendegos mamadores d barios jaja q no les da bergunsa ni los pelan ellos a ustedes y ustedes bagandoles el tramo para tirarle un mamelosn ...jaja a pues esas son las costumbres q les dan sus jefas bdd jaja pobres bastardos ..lomeros roñosos ondureños huatemaltecos muertos d ambre maqileros albañiles ruteros enpacadores parqeros jaja enfin simplement son la escoria d juarezy ustedes saben q jarudo se los cosha putos en sus ratoneras jaja...condominios jaja q C... jajacuando qeremos nos metemos a su barrio y ustedes q asen correr en cunto no bieron corrieron y mas cundo olleron los plomasos jaja pero sisi sigan d mentirosos eshenle ganas pera q se la crean ustedes saben q todos los sueños algna bes se pueden conbertir en realidad aunq el d ustedes no creo x q estan bien cagadotes y no nesesitamos d nadie para poderlos aser d awa d nuebo ai tams pues mis shabillos mamadored d pitos jajajaja..atte..SUS PADRES LOS JARDUOLOKOS

PRM ( e-mail: BORRACHOS )
Sábado 05.03.2011 / 07:42
Ustedes no acaban con nadie putos azcacas,que putas an echo? NADA. solo dar bandera tienen pendejos. puro PRMMMM.

JARUDO LOKOS ( e-mail: )
Sábado 05.03.2011 / 07:22

Sábado 05.03.2011 / 07:17

EL DRAW MSF ( e-mail: msf acg wf como ven )
Viernes 04.03.2011 / 10:36

Viernes 04.03.2011 / 09:59

PRM ( e-mail: BORRACHO )
Viernes 04.03.2011 / 09:58
Dices puras babosadas.que no te da verguensa ser tan idiota?

DOBLE U F 1 ( e-mail: WFSOTES )
Viernes 04.03.2011 / 09:13

chavalas ( e-mail: niñas )
Viernes 04.03.2011 / 00:44
k puro bla bla bla no mmamen weyes chi royiyo k estan peor k un niño tonto o de meses desmandrense ps aber si mucha accion les digo valen bergotaa pputos

jarudo ( e-mail: lokos )
Jueves 03.03.2011 / 22:22
jajjaajja nmmes we jaja nos dices roñosos lomeros jajajaa neta q eres bien bromista jajaja pinshis msfcagadotes ustedes bien sabs q estan bien cagadaotes y si qeremos nos les metemos cundo qieramos q lla no se acuerdan como corian en las ratoneras a sorri en los condominios jaja q culerote vivir ai ..asco asco jajaj q we y como le qed la troca a tu compa jajaja siganle aciendo a los vergas ..pinshis albañiles maqileros jaja bjlse los cocha en su P... barrio.e we tuu jefa se abiento buenas M... dile q mañna me caiga otrabes y le dooi susu 20 pesoso para su dosisi jaja ...pinshi bola d shapetes..son la escoria d juarez..lomeroskis ,roñososo.maqileros.albañilesjajajaja ...barrio jarudo lokos se los cocha putoas

PRM ( e-mail: BORRACHO )
Jueves 03.03.2011 / 15:03
Pues ya estoy fastidiado de estos putos mugrosos que solo corren el ocico apestoso. ahi que dejarles claro quien es la PRM.

Jueves 03.03.2011 / 12:59

123 ( e-mail: 123 )
Jueves 03.03.2011 / 11:03

PRM ( e-mail: BORRACHO )
Miércoles 02.03.2011 / 04:52

shagyOneR ( e-mail: doble u efe unO )
Martes 01.03.2011 / 17:09

shagyOneR** ( e-mail: doble u efe uno wf1 )
Martes 01.03.2011 / 17:05
barrio wf1 de tierra new segimooos en el reffuego mis chavos ok sobres de rato desde tierra new rip bola mufas

EL DRAW MSF ( e-mail: MSF ACG )
Domingo 27.02.2011 / 16:09
AQUI PURO MSF COMO VEN .......PINCHES bjl culones ni apodo ponen por culos tienen miedo de caer al suelo jajaja asi de simple pendejospinche mocoso P... no saben ni con quien se meten jajaja me dan riza pinches lomeros de M... pinches roñosos de chet echenme asu jefa pebndejos pon tu apodo P... o te awitas wey ponlo P... y donde te tope te doy suelo unos de achole quiero ver k caigan otra vez al barrio para matarlos aqui los espero cuando quieran bola de puñales igual k sus carnales los pelones jajaja pinches roñosos de M... ni para un pan tienen jajaja les tengo k dar de comer al igual k ustedes bjl P... ......ya se la saben sin detalle el draw de los msf la cuesta lokos rifa for ever asi es msf acg is my life como ven putos msf la cuesta lokos y ballanse ala V... todos los entrados los esperamos cuando quieran

( e-mail: )
Domingo 27.02.2011 / 11:56
bjlks jarudo lokos estamos d pie putos los msf jaja q esatn bien cagadotes todos lomerotes pinshis plogientos puff me dan risa,,echenle ganas ....b.jarudo lokos

DRAW MSF ( e-mail: 4:20 )
Sábado 26.02.2011 / 17:24

EL DRAW ( e-mail: MSF, ACG )
Sábado 26.02.2011 / 17:21

PRM ( e-mail: BORRACHO )
Viernes 25.02.2011 / 05:21
Ya no les queda nada,bueno nunca tubieron nada.ustedes acaban de nacer y ya los terminamos.ustedes solo son mugre de los tienen patria ni bandera por eso valen madre.dime tu historia pendejo. puro PRMMMMMM.

bbbbbbbbb ( e-mail: ggggg )
Jueves 24.02.2011 / 18:42
DOBLEUEFE UNO Descansen en pas unos cuantos homies del barrio WF1 de tierra nueva EL BOLA*EL MUFASA BATOS LOKOS FOREVER todo para enfrente nada para atras

linea ( e-mail: )
Jueves 24.02.2011 / 18:02
jaja asta pendego eres .te das mucho a conoser y no bales berga..eres un ablador el roba bicis as de ser tu ..pinchis muertos de ambre ja borracho mescaler ..tu y tu jente me la pelan si qieren atorarle lla saben donde estamos..controlando la linea todo el P... estado...

PRM ( e-mail: BORRACHO )
Miércoles 23.02.2011 / 12:32
y estos P... de abajo quien son? ni en su casa los conocen. bueno si es que tienen casa.

tHe bAbY OnE ( e-mail: SOLOS XV )
Martes 22.02.2011 / 17:35
inche 2A no la pelan ijos de la riata y siempre no la an pelado C... !! solos xv ssl controls

PRM ( e-mail: BORRACHO )
Martes 22.02.2011 / 13:53
ustedes son puro ocico,cual jale? le llaman jale a robar bicicletas? putos azcacas y linieros P... les falta mucho por eso ya perdieron la plaza. puro PRM controlando puro BORRACHO MEXICANO NOSOTROS SI SOMOS MEXICANOS y ustedes? no tienen bandera BABASOSSSSS.

sls xv ( e-mail: haciendas )
Martes 22.02.2011 / 07:00
ke viva la forntera juaritos asta la muerte pinches 2A mierdas siempre no la an pelado mas el pinche fome de M... inche jeton culero!!! solosxv controlando bachilleres 9 putos!! y ke VIVA JUARITOS!!!!!!!!!!!!!!!

Lunes 21.02.2011 / 21:12

Lunes 21.02.2011 / 21:07

LA LINEA ( e-mail: LA LINEA )
Lunes 21.02.2011 / 19:02

by 'sHAGyOneR ( e-mail: DoBle U eFe unO )
Lunes 21.02.2011 / 10:50
shagy shagy shagy shagy shagy shagy shagy shagy shagy shagy shagy shAgy shagy shagy shagy shagy shagy shagy shagy shagy wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf shagy barrio wf1 worlf five one segimos firmes el el rrefuego en tierra new 1 jejeje sobres de rato mis chavos

( e-mail: )
Domingo 20.02.2011 / 12:17

clavo ( e-mail: )
Viernes 18.02.2011 / 08:34
mis respetos para todo mi juarito x que llo soy de juarez y arriba todos los mexicanos a la vefrga todas las trensudas y los vendidos atte clavo

( e-mail: )
Viernes 18.02.2011 / 07:15
ps ami me vale V... mexicles AA o lo ke sea pro ARRIBA JUARITOS IJOS DE LA VERGA puro pinche juarez la frontera rifaa!! !! slsxv bjlHACIENDAS

BY XEUX ( e-mail: )
Viernes 18.02.2011 / 06:40

tHe bAbY OnE ( e-mail: SOLOS XV SUR 13 )
Viernes 18.02.2011 / 04:27
tHe bebe OnE SOLOS XV ones stilo playero crew graffters grafiteros forever

SHAGYONER ( e-mail: DoBle U eFe unO )
Jueves 17.02.2011 / 17:26

CLAVO ( e-mail: )
Jueves 17.02.2011 / 14:19

clavo ( e-mail: )
Jueves 17.02.2011 / 14:00
alfas saludos a los cantineros y me da gusto que esten aleonando todos los borrachos aca en la cantina de satelite estamos bien puestos tambien saludos de los borrachos de chihuas y durango y tamaulipasde parte del esniper o t8clavo

Jueves 17.02.2011 / 10:56

GUERO ( e-mail: WFZOTES )
Jueves 17.02.2011 / 10:47

felipe ( e-mail: )
Miércoles 16.02.2011 / 18:16
saludos para todos mis borrachos de parte de un soldado del prm aca seguimos camellando lla llevamos barias plumas en la bolza y emos borrado barias lineas sigo asiendo mi camello esperando y esto se resuelva rapido x que lla beo serca la vicoria

EL FR ( e-mail: )
Miércoles 16.02.2011 / 11:27

EL FR ( e-mail: )
Miércoles 16.02.2011 / 11:19

EL HM ( e-mail: )
Miércoles 16.02.2011 / 10:48

EL HM ( e-mail: )
Martes 15.02.2011 / 10:29

HH MM ( e-mail: )
Martes 15.02.2011 / 09:49

EL ( e-mail: )
Martes 15.02.2011 / 06:15

EL H M ( e-mail: )
Martes 15.02.2011 / 06:12

( e-mail: )
Lunes 14.02.2011 / 06:21

prm ( e-mail: )
Lunes 14.02.2011 / 04:31

PRM ( e-mail: BORRACHO )
Viernes 11.02.2011 / 07:46
Pues quien esta tu?

123 ( e-mail: 123 )
Viernes 11.02.2011 / 07:32

PRM ( e-mail: BORRACHO )
Viernes 11.02.2011 / 04:36
Que lastima que ustedes sean unos poquiteros,por eso perdieron la plaza,por eso dan lastima, por eso y mucho mas ustedes son los que no sirven para nada ya que son la bacteria de Juarez. ustedes son unos P... roba bicicletas.

( e-mail: )
Jueves 10.02.2011 / 15:45

PRM ( e-mail: BARRACHO )
Jueves 10.02.2011 / 05:36
Que groseros,pues que no les da verguensa tanta majaderia? yo solo quiero saludar a mis carnales de la PRM. puroooo BORRACHOOOOOO......

( e-mail: )
Jueves 10.02.2011 / 04:16
freto C... tu P... madre jajajajajaja

DARYONDEADO ( e-mail: )
Miércoles 09.02.2011 / 16:38

el t o ( e-mail: )
Martes 08.02.2011 / 10:59
m la maman todos los del muro atte el freto putos

PRM ( e-mail: BORRACHO )
Lunes 07.02.2011 / 08:31
Claro que si carnal yo estoy mas que puesto y con gente suficiente para partir madres. ya saven como trabajamos por algo estamos ganando plaza.A SI ES CARNAL PURO PRM REVOLUCIONARIO.

( e-mail: )
Lunes 07.02.2011 / 06:11

PRM ( e-mail: BORRACHO )
Lunes 07.02.2011 / 04:58
Estan ardidos porque ya perdieron la plaza pinches fracasados AZCAAACAAASSS eso son ustedes unas mierdas. ni en juarez pueden hacer algo valen madre fracasados. puro PRM COMPA.

puto ( e-mail: )
Domingo 06.02.2011 / 19:41
vean este video

Domingo 06.02.2011 / 16:41

( e-mail: )
Viernes 04.02.2011 / 14:26
freskooos loookooooos!!!!!!!!!!!

seNor hongoman ( e-mail: )
Viernes 04.02.2011 / 09:50
ey yo tengo hongos de todos coiores a y tanvien tengo mota are o k este es mi fon 2875431 markame o si no ayi m acoplo en el altitu

forever ( e-mail: )
Viernes 04.02.2011 / 09:42
a grasias por tus saludetes werota y aese P... m a la V... el freeone t cocha

aaaaaaaaa ( e-mail: )
Jueves 03.02.2011 / 08:54
un saludo a mi amorsote el daderouner de los world fives de tierra nueva

Miércoles 02.02.2011 / 08:26
Estodo carnal,me gusta ese animo asi son los REVOLUCIONARIOS y la plaza ya esta ganada pero estos putos grañudas no lo quieren aceptar aunque ya perdieron gente y terreno. asus ordenes carnal. puro PRM.....

MEXICO ( e-mail: PRM )
Miércoles 02.02.2011 / 06:01

whitch D: ( e-mail: )
Martes 01.02.2011 / 15:32
necezito konekte de hongoz y mota chida¡!

PRM ( e-mail: BORRACHO )
Martes 01.02.2011 / 13:21
Me da mucho gusto sever de mi gente,aqui en mi cantina esta todo machin y gracias carnales por reprecentar la PRM,soy Arvizu y traigo una ostia trabajando y necesito que se reporten diganme y les mando mi directa. puro PRM Razaaaaaaaaaa

( e-mail: )
Martes 01.02.2011 / 09:39

PRM ( e-mail: BORRACHO )
Martes 01.02.2011 / 06:56
Gracias carnal. yo soy Ostion al igual que ZAPATA reprecentando el BORRACHO. me gustaria brindar con usted, digame y la mando mi directa. PRM el ARVIZU.

123 ( e-mail: a 123 )
Martes 01.02.2011 / 06:01

PRM ( e-mail: MEXICLES )
Lunes 31.01.2011 / 16:30
Pinches coyones AZCACAS o como se hacen llamar? ni en pricion, ni en la calle se les quita lo ocicon. novalen madre. puro PRM. ya lo comprobaron, o NO ??????

Lunes 31.01.2011 / 14:57

PRM ( e-mail: MEXICLES )
Lunes 31.01.2011 / 14:03

Lunes 31.01.2011 / 12:25

PRM ( e-mail: MEXICLES )
Domingo 30.01.2011 / 17:24
Azcacas y los poquiteros de la linea de pendejos,pinches collones.ya todos saven que todos ustedes valen madre y no corren nadaaaaaaaaaaaaa. La PRM manda.

Domingo 30.01.2011 / 16:18

PRM ( e-mail: MEXICLES )
Domingo 30.01.2011 / 04:37
La PRM tambien. puro BORRACHOOOOOOOOO.............

( e-mail: )
Sábado 29.01.2011 / 21:33
los jarudo siguen vivoooosss

Mctrak ( e-mail: )
Sábado 29.01.2011 / 09:25
Q tranza bola d chavalas el swk d juaritos controla para toda la P... gente chavala nosotros no andamos con P... el osmik el oster ell miek el mc trak y los q le siguen recuerden nosotros no andamos con M... swk controla y rifa putos jajajaja m dan lastima putos

PRM ( e-mail: MEXICLES )
Viernes 28.01.2011 / 10:02
y quien eres tu P... ignorante ? un estupido mas ? orale pues. que putas representas babosoooooo.

BY ZEUZ WUAN ( e-mail: )
Viernes 28.01.2011 / 09:32

( e-mail: )
Viernes 28.01.2011 / 09:25

PRM ( e-mail: BORRACHO )
Jueves 27.01.2011 / 17:01
Pienso que eres culo, ni escribir sabes. estas bien wey y pendejo.

BY XEUXONE ( e-mail: )
Jueves 27.01.2011 / 12:34

BY XEUXONE ( e-mail: No No no )
Jueves 27.01.2011 / 12:20

PRM ( e-mail: BORRACHO )
Miércoles 26.01.2011 / 15:51
Quien? los AZCACAS? Ohhooo¡¡¡ los originales? osea los mas pendejooooosssssss.

Miércoles 26.01.2011 / 09:08

gato ( e-mail: )
Domingo 23.01.2011 / 10:29
pinches mariquitas dejence de M... y pongance a trbajar

SIETE ( e-mail: )
Sábado 22.01.2011 / 15:36
estodo mi sego asi debe de ser BARRIO SIETE LOCOS los demas son perillotas.

Jueves 20.01.2011 / 10:23
Los AA ? y quienes son la gente del CHAPO? putos azcacassss......

PRM ( e-mail: )
Jueves 20.01.2011 / 10:18
Son culos bola de P... linieros mugrosos ustedes no corren nada son puros poquiteros. NO VALEN MADREEEE.

Jueves 20.01.2011 / 09:06

ILIAN ZAMANTHA ( e-mail: )
Miércoles 19.01.2011 / 14:55
q pus q m3elo aga chidote

( e-mail: )
Miércoles 19.01.2011 / 12:26
estee meckiyoo del sego de dondee saliooo hahahaahhaahahahah siguees vivoo cucarachaaa jajajajajaaj pinchi chavillo mion BEJOTAELESOTA siempre te ha cochaaa mijooo RPSCREEW

( e-mail: LEYVA@ )
Lunes 17.01.2011 / 07:32

SEGO ( e-mail: LEYVA@ )
Lunes 17.01.2011 / 07:29

fome ( e-mail: )
Sábado 15.01.2011 / 23:55
orale esta madre esta chida!!!! saludos ala jente!! de la altavista home boys!! el fome

PRM ( e-mail: )
Viernes 14.01.2011 / 09:45
Puro BORRACHO PRM,viva la PRM putosssss.

( e-mail: )
Jueves 13.01.2011 / 16:57

LA._______________ ( e-mail: )
Jueves 13.01.2011 / 12:18
pura lineota putos doblados ya no qeda ninguno de ustedes weies no valen V... haha

( e-mail: )
Jueves 13.01.2011 / 12:05

SHAGYOneR ( e-mail: W**F**1 )
Lunes 10.01.2011 / 13:00

PRM ( e-mail: )
Sábado 08.01.2011 / 05:45

wofe ( e-mail: )
Viernes 07.01.2011 / 20:23
b. j A R U D O . L O K O S . E L . W O F E HAHAAHAHA barrio jarudoo lokoss hahahaa

tok el paso ( e-mail: )
Viernes 07.01.2011 / 20:17
los kee lee isieronn esoo a loss dle jarudoo ess puraa emvidiaa pinchii bolaa dee lomeross sicarioss mugrososs drogadictoss amarrensee un huevo y rompansee laa madree pa putasoss paa kee kon kuetess putoss sii see krenn vienn vergass densee enn laa madree a putasoss kon los del jarudoo esoss weiess del jarudoo noo nesesitan pistolas paa darsee en la madree esoss sonn huevoss de barrioo pinchiss mugrososs piojososs de mierdaa hahahahaahhaah

( e-mail: )
Jueves 06.01.2011 / 14:50
kien escribio esa pendaja k nos ban a matar sy ustedes disen no son los de la linia pendejetes si no saben no hablen porfabor

SEUSONE ( e-mail: LKS )
Jueves 06.01.2011 / 11:27

Jueves 06.01.2011 / 11:23

PRM ( e-mail: )
Miércoles 05.01.2011 / 12:32
La PRM presente y dejando huella para que los mexicanos la sigan.puro PRM REVOLUCIONARIO.

bjARUDOl ( e-mail: )
Miércoles 05.01.2011 / 11:58
jajajajaja seguimoos de piee putos! ANIMO

SHAGYONER ( e-mail: W......F......1 )
Miércoles 05.01.2011 / 04:17

PRM ( e-mail: )
Martes 04.01.2011 / 11:24
Que te duele? pues que no te caen bien los PRM? porque? AAAHHH. ya se porque, porque son los que corren el te aguites nosotros si los queremos a ustedes los queremos mucho.

( e-mail: )
Domingo 02.01.2011 / 16:41

la_craziitaww ( e-mail: )
Viernes 31.12.2010 / 16:13
poes ke roiio...tsss la neta yo soy nueva en este lugar poes komo dice mi primitow hay ke hacer deporte y para eso pss yo digo ke la mas divertida es parkour jejeje... bno bye kuidence mis chavoss

el darck ( e-mail: puro parkour )
Viernes 31.12.2010 / 16:09
oygan ai q tomar todo con calma ok si estan estresados ps ay q hacer parkour eso les bajara los nervios ok si no saben q es parkour beanlo en youtube ok los dejo el darck es el q les abla ok

el darck ( e-mail: )
Viernes 31.12.2010 / 16:06
el darck es el que manda

LA._______________ ( e-mail: )
Viernes 31.12.2010 / 09:59
al P... qe se kre prm no lo vamoz a meter hijo de su P... madre no mucho pinchi roio pinchi tekatiko P...

el dead ( e-mail: el deader locochon )
Viernes 31.12.2010 / 08:55

PRM ( e-mail: )
Jueves 30.12.2010 / 10:19

Jueves 30.12.2010 / 08:21

''SHAGYONER'' ( e-mail: B* ''WF1'' )
Jueves 30.12.2010 / 07:54

PRM ( e-mail: )
Jueves 30.12.2010 / 04:09
Que grosero,no te da verguensa decir esas palabras tan feas? La linea? cual linea?AH.La linea de pendejos? o la linea de idiotas o la linea de novatos e ignorantes?

LA._______________ ( e-mail: )
Miércoles 29.12.2010 / 19:21
ha ha ha pinchiz doblados nos pelan la vergaa todoz hijoz de su P... madree

( e-mail: )
Miércoles 29.12.2010 / 15:08
theeedobleea lokozzz pokoos peroo lokos

la linea ( e-mail: )
Miércoles 29.12.2010 / 10:43
att.el pewe Y el qeyko desde el pinchi cereso putos

LA._______________ ( e-mail: )
Miércoles 29.12.2010 / 10:40
ya dejence de M... todos los pinchis barrios jediondos qe aorita no es para estar de choloz x internet pinchis mediokres aorita la guerra apenas esta empezando y no acabara

( e-mail: )
Miércoles 29.12.2010 / 10:35

( e-mail: )
Miércoles 29.12.2010 / 09:18

Rojo ( e-mail: )
Miércoles 29.12.2010 / 09:08

BORRACHO ( e-mail: )
Martes 28.12.2010 / 16:31
La PRM esta muy superior a cualquier grupo de mocosos novatos robo bicicletas,el nombre lo dice todo.PRM PRM PRM.

LA._______________ ( e-mail: )
Martes 28.12.2010 / 13:16

BORRACHO ( e-mail: )
Martes 28.12.2010 / 10:47
Eres muy diplomatico y valiente FELISIDADESSS.puro PRM EEESSSSEEEE....

(SAW) ( e-mail: )
Martes 28.12.2010 / 10:39

BORRACHO ( e-mail: )
Lunes 27.12.2010 / 15:35
En juarez y todo chihuas la PRM precente y reprecentando al REVOLUCIONARIO. puro PRM COMPAAAAAAAAA.

*kYLOS* ( e-mail: )
Lunes 27.12.2010 / 11:40

BORRACHO ( e-mail: )
Lunes 27.12.2010 / 11:37
Aqui reprecentando la PRM y dejando huella como siempre.puro PRM razaaaaaa.

k-koko ( e-mail: )
Lunes 27.12.2010 / 11:17
ke tranza pinshis bamberos culos unidos jarudo y los ke le sigan la cuesta es de "los fck"putos bien saben ke kontrolamos pinchibola de cholos culones maman V... soy el -5 en la magoffin y brown "foilersotes"

SHAGYSTER ( e-mail: WFOneS )
Lunes 27.12.2010 / 03:11

BORRACHO ( e-mail: )
Domingo 26.12.2010 / 12:34
Esos REVOLUCIONARIOS,donde andan? Saludos a todos mis carnales de la PRM y lavanto la BOTELLA para desearles un feliz año nuevo.

EL JIMMY ( e-mail: )
Sábado 25.12.2010 / 18:06

BORRACHO ( e-mail: )
Sábado 25.12.2010 / 08:46
Tranquilo no te enojes se te va a derramar la vilis y es navidad.

( e-mail: )
Viernes 24.12.2010 / 08:04
cHinGeee a zuu madree ustede putto theedobleea

( e-mail: )
Viernes 24.12.2010 / 05:13

( e-mail: )
Jueves 23.12.2010 / 18:05
pfff nooo mancHeez

kanter ( e-mail: dfa1 )
Jueves 23.12.2010 / 17:56
caca para todos n sta nabida

( e-mail: )
Jueves 23.12.2010 / 16:24
Waaaz uup GeenTee aQuuii andamooz loosdoobleea lkz paara loo Quee zeerse

BORRACHO ( e-mail: )
Jueves 23.12.2010 / 15:22
Que pues raza, estan o no estan con la PRM? no somos nuevos ya tenemos historia.PRM aqui y donde quieran culeros.

( e-mail: )
Jueves 23.12.2010 / 13:11
ooo Tee Qaala Quee thuuu pinshee barrioo se conoskaa nada maaas poor andarr koon loos aztecaas noo mammeez weei hhaahaa theedooblee a pinsheez tepporoochooz pfff de rattoo theedobleea lkkz

( e-mail: )
Jueves 23.12.2010 / 13:07
Tee Qala pinshee triizte puroo doblee a puToo a zii nadaa maaz

ARVIZU ( e-mail: )
Jueves 23.12.2010 / 06:31
puro PRM la autentica familia maxicana en las calles y en pricion controlamos el jale. los azcacas son culos escuincles robo viejitas.

MR*DREECK ( e-mail: BYG.TRISTE 13* )
Jueves 23.12.2010 / 03:46

zsi CCC kzs.. ( e-mail: )
Miércoles 22.12.2010 / 14:07

Miércoles 22.12.2010 / 11:27

kanter ( e-mail: DFA1crew )
Miércoles 22.12.2010 / 11:15
e aki el grafitero con mas presensia d todos..jaja elkanter de los DFA1crew...saludos a todos...

( e-mail: )
Miércoles 22.12.2010 / 04:51
tatoos 13 el ckloner

[ne[x]y]onerzetha] ( e-mail: )
Martes 21.12.2010 / 11:16
k tranzaaa akii la nexyonerzethaa reportandose (H) jojo akuuu,,& k me shagyy esos penches mnsjs k mandelos alaa gaver mejho....!

Martes 21.12.2010 / 10:12

'FLEKONE' ( e-mail: )
Martes 21.12.2010 / 09:31

theedobleea ( e-mail: )
Lunes 20.12.2010 / 13:09
theeedobleea lokos contolando juaritooz le guzte al k le guzte i si noo pudranzee

Lunes 20.12.2010 / 10:34

cholo ( e-mail: )
Domingo 19.12.2010 / 17:37
soy cholo y que me gustan que me la metan los de mi barrio siempre me van a gustar las veergas putoos! jarudotes pa la raza

ARVIZU ( e-mail: )
Domingo 19.12.2010 / 06:35
yo odio alos que odian a los mexicanos.los mexicanos son los H... ones y los que corren el jale puro PRM compaaaaa.

( e-mail: )
Domingo 19.12.2010 / 02:17
odio a los putos mexicano!!!!!!!!!!!!!!!!!!!!!!!!!!!!

sees ( e-mail: )
Sábado 18.12.2010 / 12:55
Vayanse ala V... picnhe vieja que me esho la shota ase 3 semanaas coman pitooooo me voy a a vengaaar ala vergaaaaaa!!!!!!!!!!! las voy a matar C... por pinches chismosas

SHAGYONER* ( e-mail: W F 1 LkS* )
Sábado 18.12.2010 / 03:59

ARVIZU ( e-mail: )
Viernes 17.12.2010 / 15:43
PRM eso carnales vamos con todo.

theedobleea ( e-mail: )
Viernes 17.12.2010 / 10:34
zaluudando a todooz looz doblee a munii y rinconez

theedobleea ( e-mail: )
Viernes 17.12.2010 / 10:29
calllezee putoo no mamen primero aprendan a escriibir pinshees lomeros de M... jajaja apesta a puroo san pancheerro hahaha theedobleea lokooz hohoho

ARVIZU ( e-mail: )
Viernes 17.12.2010 / 10:07
solo la PRM save correr el jale y solo los azcacas saven correr el ocico. ANIMO MIS BORRACHOS puro PRM.

SHAGYONER ( e-mail: b WF1 ** )
Viernes 17.12.2010 / 09:10

WF1 ( e-mail: SHAGYONER )
Jueves 16.12.2010 / 10:29
PFF BALEN PARA PURA VERGA JEJEJE 2a de kakas jejeje ni si kiera pones kien eres culon ni de donde son jeje balen pa pura madre jejejeje world five one de tierra new culon jejeje

e---------mail empe ( e-mail: )
Jueves 16.12.2010 / 10:09

LA ------------ ( e-mail: )
Jueves 16.12.2010 / 10:05

LA ----------- ( e-mail: )
Jueves 16.12.2010 / 10:02

HTTP ( e-mail: )
Jueves 16.12.2010 / 09:54
ATTE LA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- K PUTOS

ARVIZU ( e-mail: )
Jueves 16.12.2010 / 06:48
puro PRM BORRACHOS REVOLUCIONARIOS, bola de P... pinches azcacas valen madre jotos verijones. puro PRM razaaaaa.

( e-mail: )
Jueves 16.12.2010 / 05:38

( e-mail: )
Miércoles 15.12.2010 / 15:08
doooblee aa puutos pinshe wf1 me los pazo por los huevos de seguro an de ser puros pinshe lomeros de mierda

( e-mail: )
Miércoles 15.12.2010 / 14:58
noo mamen pinsheez wf1 pinshee bola de mamadorees nosotros no necesitamos de nada culeroos i shingeen a toda su madree ustedes putoos el doble a vive putoos leez guzte o no les guzte

B J A R U D O L . OKOS ( e-mail: )
Miércoles 15.12.2010 / 12:12

SHAGYONER ( e-mail: WF1 )
Miércoles 15.12.2010 / 11:26

AAC ( e-mail: )
Miércoles 15.12.2010 / 05:22

DOS A LOKOS ( e-mail: )
Miércoles 15.12.2010 / 05:18

( e-mail: )
Martes 14.12.2010 / 15:45

omar ( e-mail: )
Martes 14.12.2010 / 14:38
byanse a la berga todos puro calle 24 y wsl somos los mejores cabrones

crak ( e-mail: )
Domingo 12.12.2010 / 13:12
no mames cabeza dole u jajajaja a ni sabes k ibentar pendejoo lo k es aser crecer un barrio komo los 2ac k si es barrio no H... aderas komo la tuya mierdaaaaaa doble u hahah pinxes mierds el doble a puthos

conciensia ( e-mail: juarezsocietyfree )
Sábado 11.12.2010 / 15:34

monika!!... ( e-mail: )
Sábado 11.12.2010 / 11:42
ey k transa!!.na ps aki nadamas djand0 presencia,ia dejen suz pinzhes M... d l0s barri0s neta!.se ven mal ez0 ia paso,pero en fin es zu ped0,sy una m0rra shida d parys ay pa kuand0 le kieran kaer morrit00s tenw0 bariedad d amiwas y n0 es p0r tirar muzha M... pero ps tenem0s stil y estam0s bn buenas jaja!!..ay pa k0t0rrearla ya se la zaben.........trusha,kabrones.

dooblee a ( e-mail: )
Viernes 10.12.2010 / 14:02
vaiazee ala verGa uSteed puTo puro doble a lokos te Guzte o no te Guzte zomo los mejores

b*wf1 ( e-mail: wf ZoTeSones )
Miércoles 08.12.2010 / 14:11
H... en a toda su madre esos weyes dela doblea wf1 c los cocha kuleros y saludenmen a sus jefas

( e-mail: )
Miércoles 08.12.2010 / 13:25
Q traanza jentee aki levantandoo el barrio mazz peesado doblee a lokoz zaludando alooz 2ac munii

( e-mail: )
Miércoles 08.12.2010 / 13:21
ezze pinchee roio k doble u no mamen weiez mamando inventenze otro pinshe barrio putooz doblee a lookotez

SHAGYONER** ( e-mail: DobLe U eFE UnO )
Miércoles 08.12.2010 / 01:08

perla ( e-mail: )
Martes 07.12.2010 / 10:39
puros unidos los cocha putos y mas al pinchi jarudo mierrda jaja a la berga putos

lluvia marisol ( e-mail: fdhjvfh8gyfmnh. , )
Martes 07.12.2010 / 03:32

sHAgyOneR* ( e-mail: wF1 ** )
Martes 07.12.2010 / 01:15
k transa k transa ps aki el shagyoner de los wf 1 de tierra nueva ok los world five somos bien aleegressss putos

antonio dias ( e-mail: )
Sábado 04.12.2010 / 09:29
deseo conbocer chgixcas sexuales

b.unidote 14 ( e-mail: )
Viernes 03.12.2010 / 09:58
el pynchi DUEK de laa MUK putoz

weroner sbc ( e-mail: esebece )
Miércoles 01.12.2010 / 03:35
somos pokos pero lokos en este barrioo hay puro adolecente y en la riña le salimos todo para y alos entrados nos ven pasar y se kedan agachados nos antes pediamos colores para colorear haora pedimos aersosoles para rayar atte weroner sbc fe2chika central

weroner ( e-mail: esebece )
Miércoles 01.12.2010 / 03:30
soy del barrio fe2chika central rifando en la zona de la periferia para lo k seles ofresca el weroner sbc

( e-mail: )
Martes 30.11.2010 / 12:18
el doble a putos

deniisss ( e-mail: )
Martes 30.11.2010 / 10:42
el pinxe ower es pura labia es una M... el wei i su barrio ia ni existe se cree vergas i ni trae nada el wei i thu desasera los doblados jajajajajajajaja no mamaes weeeee a i otra kosas io kreo k ia no ai 2ac pndejo de mierdaaa a i soi una morra k te konose super bn pndjo m kaes en los k no tengo idiotaaaaa ate: denissee mierda jaja gordo

bjl lbp ( e-mail: )
Martes 30.11.2010 / 10:10
k roio px aki kntestando alas k tanto me odian px mejor dicho para las ardidas sea lo k sea fui la primera y seguire siendolo jajajajaj a la verwa las ardidas k me tienen envidia y km io no soe del bajo mundo ps klaro k a perras km tu nunk les boy a ganar xk personas km tu en eso tyenen experiencia bye y siwe ablando de my se k no tienes vida propia

piton ( e-mail: .l. )
Martes 30.11.2010 / 00:23
puro pinchi cholo roñozo y askerozo raya aki pinchis cholos no valen V... P... dan asko a la V... y H... en a su P... madre los malillas .l. A LA VE

HARUDO ( e-mail: )
Lunes 29.11.2010 / 11:59

SHAGYONER**** ( e-mail: WFZOTESsssOneS!!! )
Domingo 28.11.2010 / 12:49

PBU 14 ( e-mail: )
Domingo 28.11.2010 / 08:49

CINDY ( e-mail: lachata )
Viernes 26.11.2010 / 21:22
k tranza mi dead k aciendo,k ya no abla x le pegan aok??

PASOS ( e-mail: )
Jueves 25.11.2010 / 16:13

EL OWER DE LA GSK ( e-mail: )
Jueves 25.11.2010 / 07:44

EL OWER DE LA GSK ( e-mail: )
Jueves 25.11.2010 / 07:41

LoRs-HeA ( e-mail: elLORStkocha )
Miércoles 24.11.2010 / 09:31

SHAGYONER*** ( e-mail: WORLD FIVE * WF )
Martes 23.11.2010 / 14:06

( e-mail: dkpcreww )
Lunes 22.11.2010 / 13:24
k rroyoo mis chavosss akii su padree el wykesss dll cuesta lokosss jaja pura dkpsotaaa putoosssss,,dkpcrewww

shagyman ( e-mail: B WF1 BY T.N. )
Lunes 22.11.2010 / 13:11

SUENOKER ( e-mail: SUENOkerone )
Lunes 22.11.2010 / 12:05

CROMO ( e-mail: EGO )
Lunes 22.11.2010 / 08:30

SUENOKER ( e-mail: SUENOkerone )
Jueves 18.11.2010 / 10:25
aki esta el suenoker de la SWK DE LA OBRERA putos pocos pero locos ssl

el flow cia crew,,, ( e-mail: )
Jueves 18.11.2010 / 07:35
saludos atodos los grafers de cd juarez carnales echenle ganas suerte con las pintas salu2 el flow cia crew,,, cd juarez,,,,

NOokSeeR ( e-mail: )
Viernes 12.11.2010 / 15:39

XXEEUUXX ( e-mail: BAMBA 87 )
Viernes 12.11.2010 / 09:51

( e-mail: )
Jueves 11.11.2010 / 13:49
k pinchis uniditos 14 binieron a balasiarnos pero se la pelaron por k no m mataron aki sigo presente el tomate del barrio jarudo lokos y al rato ba el deskite no mas no se deskuiden putos el barrio jarudo lokos rifa aki el tomate me la pelan

el mero mero ( e-mail: )
Miércoles 10.11.2010 / 08:51
Aqui en juaritos puro stylo matón

BMB ( e-mail: )
Miércoles 10.11.2010 / 06:44

Miércoles 10.11.2010 / 06:24

la linea_____. ( e-mail: )
Martes 09.11.2010 / 22:05
LA LINEA NUNCA ACABARA PENDEJOS NOMAS MIRA LAS PRISIONES AZTECAS ASTA LA MUERTE nostros estamos limpiando esta ciudad de ustedes los sinaloenses culos q quieren mas poder del que tienen jaja pero aqui en juarez SE LA PELAN manden mas federales andale calderon sige cubriendo al chapo alrato aver quien te cubre ati

cLik united 14 ( e-mail: )
Martes 09.11.2010 / 13:11

HUMOERONELL ( e-mail: )
Lunes 08.11.2010 / 13:17

kiikee ( e-mail: )
Viernes 05.11.2010 / 21:37
la barrio kinta sur rifa putos kinterotes lokotes pokos pero lokos

( e-mail: )
Viernes 05.11.2010 / 19:26
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!! BiEn maRiGuAnO aStA lA mAdRe !!!!

( e-mail: )
Viernes 05.11.2010 / 19:23
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!!

FFrraaeeccKK ( e-mail: )
Viernes 05.11.2010 / 19:20
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!!

culo ( e-mail: clos )
Viernes 05.11.2010 / 09:26
que se valla ala V... el pony jaja es culote

( e-mail: )
Viernes 05.11.2010 / 08:11

Viernes 05.11.2010 / 08:07

( e-mail: )
Jueves 04.11.2010 / 17:14

miguel padilla ( e-mail: )
Jueves 04.11.2010 / 12:44
para los payasos para que gosen con el master flow para quesientan elcocotaso

neyfii ( e-mail: )
Jueves 04.11.2010 / 11:46
k ondaaaaa kiero dar un mensaj3 a un P... k se yama geovani jajaja

daver ( e-mail: )
Jueves 04.11.2010 / 09:32
k royo putos aky el daver msf y el dary el bowe tgk dando guerra xlos kulytos k rayan kn l kulo

bogar ayala ( e-mail: )
Jueves 04.11.2010 / 09:26
aky el dary bowe fak tgk south side

( e-mail: )
Miércoles 03.11.2010 / 10:45

CROMO ( e-mail: CROMO )
Miércoles 03.11.2010 / 10:38

Miércoles 03.11.2010 / 08:13

sKOR BJL ( e-mail: )
Martes 02.11.2010 / 15:28

DEADERCOCHON ( e-mail: )
Martes 02.11.2010 / 08:27
ja.ja mira scor megor no empieses a cagar la V... keriendo tirar tu royo por k alultimo los k le andan saliendo porty es tu abuelo y tu tio kana por k tu eres bien chavalota pinchi nina by D.E.A.D

sonek paint street ( e-mail: )
Martes 02.11.2010 / 08:15
SaludOs para toda la banda de la ack lcg y pa los paint street crew tambienpara los trk bsk para todos los k conosen al sonek da la PS

skoR ( e-mail: B.JARUDO LOKOS )
Lunes 01.11.2010 / 18:31

el fixo ( e-mail: )
Lunes 01.11.2010 / 18:13
pinche bola de mocoso chavalas you all nating but wana bs this is a real og from juaritos sur trece jlc levas chapetes x3 gang mexicanos

fixo ( e-mail: )
Lunes 01.11.2010 / 18:03
juaritos como te extrano

( e-mail: tHe bAbYoNe )
Lunes 01.11.2010 / 15:29
SSSSSSSSSSoooooooloooooosss xv

tHe.BaBy.OnE ( e-mail: )
Lunes 01.11.2010 / 15:26
kE RoLlO KuLiToS Pz aK eL BaBy oNe dElO S SoLoTeS Xv sOuTh sIdE LoKoTeS RiFaNdO En hAcIEnDaS uNiVeRcIdAd

( e-mail: )
Lunes 01.11.2010 / 10:26
elstik hijos de putaa jarudo lokosss

( e-mail: )
Lunes 01.11.2010 / 10:19
3 puntos putos

( e-mail: )
Lunes 01.11.2010 / 10:13
jarudooo lokos hijos de putaa

( e-mail: )
Lunes 01.11.2010 / 08:34
scor chnga tu P... madre by dead

SCOR! ONE ( e-mail: JARUDO )
Viernes 29.10.2010 / 07:32

( e-mail: )
Jueves 28.10.2010 / 10:16
todo bien un saludo para mi barrioosea el de la soli 13 homs aqui todo bien cholos sks coox crakens soli rifa cholos spoy de juares chihuahua

adrian ( e-mail: )
Jueves 28.10.2010 / 10:11
todo bien todo bien5657 miepa aqui robaron en la soli 13cholos se la aventaqro n van ava ler V... hehehehe putos todos menos los de la soli 13

Jueves 28.10.2010 / 07:59

Miércoles 27.10.2010 / 08:52

Miércoles 27.10.2010 / 08:48

FUMA MOTA ( e-mail: BCL )
Martes 26.10.2010 / 06:27

ARVIZU ( e-mail: )
Domingo 24.10.2010 / 06:39

( e-mail: )
Viernes 22.10.2010 / 10:18

( e-mail: )
Viernes 22.10.2010 / 10:11

Jueves 21.10.2010 / 19:34

ARVIZU ( e-mail: )
Jueves 21.10.2010 / 13:06
Como estan mis REVOLUCIONARIOS de la PRM MEXICLES?aca en mi canton todo tranquilo. y ustedes q transa mis BORRACHOS?

cLik united ( e-mail: )
Miércoles 20.10.2010 / 18:58

LoRs-HeA ( e-mail: )
Lunes 18.10.2010 / 18:50
aki el LORS de la HEA*BCL*4TA tirando el graff pepol ay tamos en el REALOTE y en AMPLIACION pa kuando kieran by:LORS-HEAK-4TA-BCL

( e-mail: )
Domingo 17.10.2010 / 13:13

bOReK! ( e-mail: KmT!HaCiEnDA )
Sábado 16.10.2010 / 17:48
CKE TrAnZe hOmSs!!!! el BoReK De LoS KmT de HaCiEnDa KE mI GuErO Ya sE La zaVe kE aI AnDaMOS aL tIrO i al 100 PaLoOzZ KonTrAs dArLeS plomOo!!! Ya valiErOn veRgA PInCcHeS uNIDOS aKi en hACiEnDa Ya No KeREmos vErTE pInChE bInEk AuNKe seAs noViO DE la KaRnala De ScOr yA vAlIStEs VeRga POOr SER UNiiIdoss i Ya nO mAmEs TaNtO al SCOR WeY nOmAs Pake No tE PeGeMOS pEnDeJo PiNcHe CuLoNn kMt riFA pUtos ala VerGa cON los uNidoss!! el BoREK!!!

JaRuDOtE!!!!! ( e-mail: GuERO!! )
Sábado 16.10.2010 / 17:43

Sábado 16.10.2010 / 17:39
cKe tRaNZAAA GENTE AKI EL SKORe and gueronEr del barrio jArUdO haciendota!! ay estamos rraza i ala vergaa los pinches entrados y lomeroos cagados!! ee pinches unidos no valen V... pinche bless kieres mas V... mas V... vas a tener!! culeroo!!! acuerdense ke ustedes son unos pinches terrosozz ke se creen narkoos pero no valen verga!!! pork nomas hablan i tiran cuetazoz al aire bola de P... el skoRE LOS COCHA DE HACIENDA UNIVERSIDAD!!!AND GUERONE!!! PUTOS!!!

mr. big blesss ( e-mail: mexican united kriminal )
Viernes 15.10.2010 / 12:13
pinchis jarudas siempre abriendo la mamadora nomas como siempre estan peor ke las putas inventando chismes son matones pero de internet ojala fueran asi en la calle ya saben ke no son de ule P... pero ya saben a ki stoy para cuando kieran venir a cenar plomo de verdad con los united en la calle no por kartitas en la compu como las rukas ke son ke siempre tenemos ke ir de vista por ke les tiembla la donita venir

Jueves 14.10.2010 / 08:23

Jueves 14.10.2010 / 08:17

pinchis kulos ( e-mail: )
Miércoles 13.10.2010 / 10:24
que mi uniditos como les kedo los weyes que lebantamos pinchis kulos i disen k no fueron ustedes asi me gustaban llorones i no lo bamos a dejar asi lebantamos a puro longo . pero no que balla pasar mas nomas pongasen trcuha bamos por los chikos pinchis chablas ATTE LOS JARUDOS.

( e-mail: )
Miércoles 13.10.2010 / 10:10
puro pa delante jarudo que lla nos ban a mamar los msh kana

luis ( e-mail: )
Miércoles 13.10.2010 / 10:07
barrio jarudoo loco bjl

Miércoles 13.10.2010 / 08:17

CROMO ( e-mail: CROMO )
Miércoles 13.10.2010 / 04:34

Martes 12.10.2010 / 06:23

Cindy ( e-mail: hola a todos )
Domingo 10.10.2010 / 17:06
Saludos a todos por que creo que si estan a qui es por que son personas interesantes.... Bamos animooo a vivir y a vivir bien.... Gente. No somos unicos somos inigualables.

Sábado 09.10.2010 / 05:13

( e-mail: )
Sábado 09.10.2010 / 05:04

el dead locochon ( e-mail: )
Viernes 08.10.2010 / 12:01
para k tiran tanto rollo megor dense de bergasos y ya putos para k kieren cuetes k sin cuetes no pueden by el dead.

( e-mail: )
Viernes 08.10.2010 / 10:33

Viernes 08.10.2010 / 10:28

el deader cochon ( e-mail: )
Viernes 08.10.2010 / 08:30
k transa putos el dead de la seventeen lockos MSH CONTROL

b.unido 14 ( e-mail: )
Jueves 07.10.2010 / 14:14

SHAGYMAN ( e-mail: BWF1 )
Jueves 07.10.2010 / 09:23

EL DEADER COCHON ( e-mail: )
Jueves 07.10.2010 / 08:20

puRa pincHi pBu k ( e-mail: )
Miércoles 06.10.2010 / 18:36

el deader cochon ( e-mail: )
Miércoles 06.10.2010 / 08:49
msh locotes el dead one de la seventeen putos el uniko i orijinal ay nomassss/

gckrew ( e-mail: sicko )
Martes 05.10.2010 / 16:45
UNICKER SER!!!!!!!!!!!!!!!! GECEKA CREW!!

BJL----- ( e-mail: )
Lunes 04.10.2010 / 17:56
Jaaaaaaaaaaaa,,,,,KUIDEZEE MI SPOK....POLE.....BLES VAN A VALIRR VERGAAA....Jaaaaaaaaa,

memo ( e-mail: no tengo )
Lunes 04.10.2010 / 13:55
que transa putos aqui saludando el fluzone de la kfw 18 rifando putoa

unidos X4 ( e-mail: )
Lunes 04.10.2010 / 11:42
jajaja buen rollo mis jarochos de rato les kai la otra llubia de plomo haora va para el pinshi mocoso del klen i sus compiyas y el snaf ia mejor tiro culon pinshi shapetiyo y el putiyo de spek tmb va a valer berga... ai de rato mis shavillos unidet•14

PB7! ( e-mail: )
Domingo 03.10.2010 / 19:13
jajajaja sii wei sigue tirando tu qaqa! si bn sabes qe el BARRIO SIETE siempre te a qoshado ala braba!

( e-mail: )
Domingo 03.10.2010 / 09:13
avver los del siente que pinchi terrosos asquerosos haha nos asecamos ala carretera HAHAHAHAHAHAH simon mi chavillo tirando rol en su barrio tachandoles todos sus murales ( CUALES ) hahhahaha i no la pelan bieen saveen i cuando kieran disque rapersitos BALINES primero limpiese el C... compa ala vrava... i los unidos me dan RISA ni con cuete nos tumban van a wuachar como se asen esos jales sin hablar de rato 255 BARRIO INFONAVIT JARUDO LOCOS DE PIES AORA Y SIEMPRE NO LA PELAN TODOS LOS ENTRADOS I MAS LOS UNIDOS I LOS DEL SIENTE PUES NI EN CUENTA IA SON CLIENTES ( PERIYOTAS ) BJLOSCOCHAN

( e-mail: )
Domingo 03.10.2010 / 08:33
biba la pinche ciudad mas H... ona de mexico ciudad juares i un dalido atoda la rasa en ciudad juares al barrio 68 en juares son los mas H... ones atte el sombra

sees-tyle ( e-mail: )
Domingo 03.10.2010 / 07:55
SeeS-tyle graffiteando con stylo.

westone ( e-mail: Leo.alba01@ )
Viernes 01.10.2010 / 22:13
ke pedo putos al tiro con el west cabrones tu me odias x ke las ninas se saben esta cancion man e saludos al sone swkmo chido maricas y viva la spk sota loka

( e-mail: )
Viernes 01.10.2010 / 16:35
un saludo para todas las jainas grifas de parte del iserk kno

( e-mail: )
Viernes 01.10.2010 / 16:32
k transa aki bien firmes el iserk el kroef keno mandando saludos alos ups y sbi

Viernes 01.10.2010 / 14:01

UNITED 14 ( e-mail: )
Jueves 30.09.2010 / 13:39

duEEqKK ( e-mail: )
Jueves 30.09.2010 / 13:35

SHAGY B*WF1 ( e-mail: B*WF1lks T.N )
Martes 28.09.2010 / 11:06

Lunes 27.09.2010 / 16:46

Domingo 26.09.2010 / 18:26

( e-mail: )
Sábado 25.09.2010 / 23:39
727 la cuesta lokos los del 727 los kocha a todos los mugrosos de esta pagina

the axerone in memory of seraf ( e-mail: )
Sábado 25.09.2010 / 23:26
ke royo mis chavos aki el axersote y el toni de la barrio siete lokos de la kuesta rifando y cantando improvisando a todos esos weyes estoi callando y tambien para akellos ke solo stan ablando komo los jarudos ke siempre la eestan celestineando pinchi s cahvos tecatos el el axer del bbario 727 les dice P... para ke nomes noa blesn de mas saben ke el 727 los cocha chavos nadaams ke ustedes cuando viene al siet bueno ala carretera no les hacemos nada xk son puros chavillos despues los matan y ahi andan diciendo sus jefas ke eran estudiantes jaja ate axerone y el tonione de la swk lokos de la melchor

Viernes 24.09.2010 / 12:52

SHAGYONER ( e-mail: )
Jueves 23.09.2010 / 17:03

( e-mail: )
Jueves 23.09.2010 / 11:18

( e-mail: )
Jueves 23.09.2010 / 11:15

( e-mail: )
Jueves 23.09.2010 / 11:10
what sup homies de los pcl les saluda desde aki e utep el ysto derrato les caigo para aplicar el estilo del arte del graff only for art !!!!!!!!!!!!!!!725 crew breat witch milk

the kraz1 ( e-mail: )
Jueves 23.09.2010 / 06:37
zaludz a toda la chole 14 rekuerden k c les kiere machin i hechenle ganas!!!! la chole rifa putz by:iop

jasibella ( e-mail: )
Martes 21.09.2010 / 13:34
te odio tanto, espero que nos encontremos pronto en el infierno maldito infeliz, me alegro que te estes pudriendo inbecil

nokserone ( e-mail: )
Lunes 20.09.2010 / 15:59
rap solo putos desde gomitos lokos dando arte MENTES EN PINTURA STREET lokos

lUPE ( e-mail: lupe love 1108@ )
Domingo 19.09.2010 / 10:24

LUPE ( e-mail: )
Domingo 19.09.2010 / 10:01
ke tranza saludos atodos los de la guadalajara derecha en especial al kuate ,ray kb y al chikle de su kompa la lupe los extra......o putitos cd juarez es lo mejor

( e-mail: )
Sábado 18.09.2010 / 08:10

CINDY ( e-mail: CINDY la chata!!! )
Viernes 17.09.2010 / 20:41

PRM 36 ( e-mail: )
Jueves 16.09.2010 / 17:40

LOS CANCHEROS 46 ( e-mail: )
Jueves 16.09.2010 / 17:37

SeeS ( e-mail: )
Miércoles 15.09.2010 / 10:43
aqii el sees reportandose! juarez para mii es como un pizarron manchado de sangree!

'BY SEUSONE' ( e-mail: )
Miércoles 15.09.2010 / 05:13

WF 1lKs ( e-mail: WORLD FIVE ONE s )
Lunes 13.09.2010 / 17:16

Chatero2 ( e-mail: )
Jueves 09.09.2010 / 20:17
a href=www.otrochat.comOtro Chat/a

Chatero ( e-mail: )
Jueves 09.09.2010 / 20:14
Chat Chat

Jueves 09.09.2010 / 12:00

( e-mail: )
Jueves 09.09.2010 / 09:28

( e-mail: )
Jueves 09.09.2010 / 05:32

( e-mail: )
Jueves 09.09.2010 / 05:27
ME LA MAMAN PERAS ATTE BY XEUX NSK JAJAJAJAJA..............................................................................................

betle ( e-mail: )
Martes 07.09.2010 / 17:44
jajaja perros

MR.WEB** ( e-mail: IN MEMORY OF: )
Martes 07.09.2010 / 12:04

MR.WEBER!! ( e-mail: *MSH*KINGS*XVII )
Martes 07.09.2010 / 11:58

( e-mail: )
Martes 07.09.2010 / 03:58
tatuados de arte viva mexico ..caaa........sss

PAJA ( e-mail: )
Lunes 06.09.2010 / 15:35

LOS BCL ( e-mail: )
Lunes 06.09.2010 / 05:01
K PUTOS PURO NSK LA BAMBA OSK .............................................................................................................

XEUX BCL ( e-mail: )
Lunes 06.09.2010 / 04:38

M exican R ight S tyle ( e-mail: MRS c )
Domingo 05.09.2010 / 16:24
viva el arte del graff...........................................................................................................................................................................................................................................................................................................................................................MmmmmmmmmmmmmmmmmmmmmEeeeeeeeeeeeeeeeeXxxxxxxxxxxxxxxxxxxIiiiiiiiiiiiiCccccccccccccccO00000000000000000000,,,,,,,,,,,,,,,,,,,,,paz en ciudad juarez.en los corazones de cada cabroon

REVOLUCIONARTE ( e-mail: ReVoLUci0N aRt3 )
Domingo 05.09.2010 / 09:43
esta suave sigan con esas pintas todo por juarez.

adn ( e-mail: )
Sábado 04.09.2010 / 18:19
akii no0mazz levantado0 el barrio0 puro0 adn ko0mo0 lo0 diice aho0ra do0minamo0s no0zo0tro0s a zii qe pxx ni pedo0

( e-mail: )
Sábado 04.09.2010 / 09:34

SHAGYMAN ( e-mail: )
Viernes 03.09.2010 / 14:53

XEUX ( e-mail: )
Viernes 03.09.2010 / 05:27

CROMO 87 ( e-mail: CROMO NS )
Viernes 03.09.2010 / 05:07

froz ( e-mail: )
Jueves 02.09.2010 / 12:28
soy el froz de la ska de juarez un rapero de juarez ( e-mail: )
Jueves 02.09.2010 / 06:27

swk sone ( e-mail: SWKZONE@HOTMAIL.COM )
Miércoles 01.09.2010 / 09:50

XEUS ( e-mail: )
Miércoles 01.09.2010 / 05:21

XEUSONE ( e-mail: )
Miércoles 01.09.2010 / 05:14

REVOLUCION ARTE ( e-mail: rev.mexicana puestotes )
Martes 31.08.2010 / 18:07

BY SEUS ( e-mail: )
Martes 31.08.2010 / 11:02

CROMO ( e-mail: CROMO )
Martes 31.08.2010 / 05:06

nice ( e-mail: NICE )
Martes 31.08.2010 / 05:03
evitando problemas y mas problemas paz por juarez tranquilidad en juarez viva juarez arriba chihuahua como MEXICO NO HAY DOS.. Y si le seguimos no acabamos chid0 chid0

( e-mail: )
Lunes 30.08.2010 / 18:25 gente PAZ POR JUAREZ

( e-mail: )
Lunes 30.08.2010 / 18:22
estamos con el arte paz por juarez

E L E ( e-mail: KM´´ 14 unidos 14 )
Lunes 30.08.2010 / 18:18
TIRANDO LINEAS POR LAS AVENIDAS, BUSCANDO ADRENALINA EN LA CIMA ,COYOTEANDO A LOS TIRAS QUE CUIDAN,SIEMPRE Y CUANDO SEA APOYANDO VIVA LA FAMILIA..ESTE UNA ROLA DEL CABRON DE oFa ..ESTA CHINGONA BUSQUEN EN YOU TUBE oFa...........esta rola habla de un movimiento H... on que surge en agosto del 2010 en cd.juarez chihuahua..por un cambio en nuestra vidas y las de nuestr familias los UNIDOTES 14de colinas de juarez putos XXXXXXXXXXXXXX Los mores trece de lomas de san jose ..que H... ones somos saludos a mi compa el izo la letra y musica ..y este guey le gusta la tambora dele mi diyey.. in memory of el compa AROON

isaac ( e-mail: )
Lunes 30.08.2010 / 15:27
mandando el saludo desde gomitoz lokos para juaritoz shido cn su roio se estan iemdo en grande spero q nadie culee todo sea x paz y x amor al arte... zone saludos a t primo el sima departe del isaac el cuñado de negro... sobres ps sigan aventando esos bombones vien marihuanos jajaja¡PAZ POR JUAREZ!

closet ( e-mail: )
Lunes 30.08.2010 / 11:43

sees ( e-mail: )
Lunes 30.08.2010 / 11:28

( e-mail: )
Lunes 30.08.2010 / 05:26
los apoyo, vivo por belair y si se noto, oy nuevo en este portal me gusta el graff. lower valley first.Mr. play saludos a los graf´s de juaritoz apoyense los grafs estuvieron por la alameda y ya los andan borrando las maquinas.

( e-mail: )
Domingo 29.08.2010 / 06:46
que onda me tope unos paisa tirando graf y les dije que pedo eso pr que lo ponian y me dijeron que es una forma de expresarse por la violencia que se vive en mi pais MEXICO y esta chido estos chaboss tenian buen tramo y le dije a mi familia que si me llebaba aber .ellos me dijron de este neta estan ca..nes se distinguio la av. pues siempre echan arena para qe no se vea,la neta chidos no se si los conozcan pero me hablaron muy chi...zote,de lo que es su reclamo.......saludos atodos los paisanos de MEXICO , sobre todo a todos los de chiwas.naci en el D.F pero me crie en cd.JUAREZ.una ciudad bien H... ona saludos gracias pero ahora estoy indocumentado aca saludos a los espaldas mojadas cd.JUAREZ CHIHUAHUA MEXICO..GRACIAS POR TODO EXTRANO MIS RAIZES MI GENTE MI FAMILIA..OTRA GRACIAS A MI FAMILIA QUE CONFIA EN MI..todos por juarez con tranquilidad.

serone ( e-mail: )
Sábado 28.08.2010 / 23:58
ke tranza homies les mando un saludo desde la chavena en juaritos para mis homies ofak aki los kalmo en la 24 st

Sábado 28.08.2010 / 18:25

swk sone ( e-mail: SWKZONE@HOTMAIL.COM )
Sábado 28.08.2010 / 18:14

C B S c ( e-mail: d e c k onE )
Sábado 28.08.2010 / 17:51
cant be stoping CBS c que transa aca andamos por el valle bajo en el paso tx. tirando lineas de krylon paz por juarez .tranquilidad por juarez pues aya unos putos andan de ojetes que no izieron paro pues les tiembla vamos dejando linea aca desde el puente zaragoza i vamos asta el sta.fe por la av. alameda asi vamos a seguir y al que no le parezca (noesamenazanipleitocomodijoeseweyesloqeestamosevitando)ya saben donde encontrarnos este pedo es viajado y vamos a continuar, toda la gente paz por juarez...tranquilidad por juarez...............................................................Mr..DeCk...............CbS.

WF1****SHaGY ( e-mail: )
Sábado 28.08.2010 / 11:52

BCL ( e-mail: E-MAIL )
Viernes 27.08.2010 / 11:46

graff art ( e-mail: )
Viernes 27.08.2010 / 06:30
acoplen un crew ! cantoneando x las torres agregen

graff art ( e-mail: )
Viernes 27.08.2010 / 06:26
el graff no muere solo raya el que de veras quiere! sees 20I0

thre ( e-mail: paz por JUAREZ )
Jueves 26.08.2010 / 15:14
saludos al compa zone dale estoy chavo pero no me tiembla ando aca por la altavista poniendo tranquilidad en juarez y tambien paz po juarez todos me tiran rollo que caga palos y que esas M... que pero ni pedo todo sea por tratar de cambiar este pedo unas morritas se acoplaron a patrocinar unas latas y dandole aver que pedo con es guey que le dejaron las nalgotas incadas tmbien eso siguele..el thre sin crew mi barrio solo paz por juarez..saludas a las morritas del arroyo colorado que patrocinaron las latas .miss wendy.missdream.missmagick.hai esta

Jueves 26.08.2010 / 10:28

FLOW ( e-mail: MSK )
Miércoles 25.08.2010 / 18:11
que transza atodos los graf´s de la ciudad que rifensela un rato aunque sea un mezquite a estos batos cbs ofa ms swk kakos 90 ylc otk yck fws btp lo rz rivers tnuevas anapras el 27 centro central san antonio satelite zaragoza el valle casetas drs mps den ska tko vg ass ot pre tuw vbn infosol infoca infotec xxx db sed zol hio un pqm pml al ofas pl a todos apoyen este pedo para que pare pues despues no habra regreso mejor vamos asiendolo en paz y no arrepentirnos ..CUANDO YA NOSE PUEDA RESOLVER NADA By FlOw MsK.....eljuarez de siempre..................tranquilidad en juarez...

ISSAC ( e-mail: )
Miércoles 25.08.2010 / 15:13

nokser ( e-mail: )
Miércoles 25.08.2010 / 14:44
shido x juarez doblados q el graff vaia p riva saludandolos desde gomez pal. para swk departe del nais y el nokser de MPSK de gomez aki apoiandolos. aki dejando linea jaja. M P S K

*****SHAGYMAN***WF1 ( e-mail: )
Miércoles 25.08.2010 / 10:32

ARVIZU ( e-mail: prmarvizuzarazua@ )
Miércoles 25.08.2010 / 07:58

UN PUTO ( e-mail: OJETE )
Miércoles 25.08.2010 / 07:57

( e-mail: )
Miércoles 25.08.2010 / 07:53
orale pues que les temblo sigan cabrones ustedes que saben poner arte apoyense

FLOW ( e-mail: MSK )
Miércoles 25.08.2010 / 07:50

N R 2 ( e-mail: B U F O N E S c )
Miércoles 25.08.2010 / 07:41

ARVIZU ( e-mail: prmarvizuzarazua@ )
Miércoles 25.08.2010 / 07:27
Animo mi raza mezcalera puro PRM esos pinches trensudos no traen nada putos azcacas jotos.

AAC ( e-mail: )
Martes 24.08.2010 / 15:36

SHAGY WF1**** ( e-mail: )
Martes 24.08.2010 / 11:19

ARVIZU ( e-mail: )
Martes 24.08.2010 / 07:49
Viva la revolucion viva la PRM MEXICLES puro MEZCAL mi raza.

el jabies ( e-mail: tierra nueva 2 )
Martes 24.08.2010 / 06:07
neta que si wei este wei trai raya chida aca tambien eandan rayando eso tranquilidad en mi ciuadad y paz por juarez ta chidosigan con esste pedo ya los pinchis sicarios se pasaron de lansas que bueno que se miro la otra ocasion en las noticias que un cabron tubo uns hhhhhhuuuueeeeebbbbbb......................ssssss.para hacer eso y tambien me di cuenta que icieron un buen grafyty en la pgr y lo pintaron pa qe no se supiera salgan sigan el jabies tierra nueva 2 lokos rifan

grillothine ( e-mail: )
Lunes 23.08.2010 / 20:56
que roio cabrones ya hace rato que no ando rayando por las calles la verdad no entiendo mucho k pedo kon sus barrios pero poes igual io me fui mas por el royo de los teams jeje solo le kiero decir al cabron k rayo eso de kiero mi cd en paz k komo raya vergas y no ando mamando ni mucho menos pero cabron pokos en esta cd komo tu wey jeje no digo k no traiga estilo pero la verdad es k hay k saber reconocer kuando alguien raya H... on la neta sigan asi esas son buenas pintas cabrones. hay k dar de k hablar en las noticias pero no por P... de los narcos!! si no por kosas komo estas!! grillothine kapirotea2 team

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 19:10

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 19:02

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 18:55

( e-mail: )
Lunes 23.08.2010 / 13:08

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 04:39
que paso con los que segun son los matones del jarudo ya se acabo de matones a fosas ahora quieren que los entierren...jajjajajajajajajajaja pues no que muy matones que se rien de los muerttos de juarez .putos ya comense a grafitear por las calles paz por mi ciudad y queremos tranquilidad en mi cidad. y la nete to si soy cholo a mi gente del infonavit solidaridad puest0tes gente.que onda sigan homs con esto que onda zone como la llevas no he visto tus pintas el chuco trece del info sol

homosexual pasivo ( e-mail: .COMONEGRA )
Domingo 22.08.2010 / 18:12

( e-mail: )
Domingo 22.08.2010 / 08:10

Domingo 22.08.2010 / 05:43
(((((((((((((((((((((((((((((((((((((((((((((((((((((((((SALUDOS A TODOS LOS CHAVALONE QUE CONTINUAN CON ESTA PROPUESTA CONTINUEN..POR UN JUAREZ DIFERENTE.... por el juarez de siempre))))))))))))))))))))))))))))))))))))))))))))) HEY SI ERES GRAFITERO SAL A LAS AVENIDAS EXPRESA LO QUE SIENTES POR JUAREZ.. Attecjm 0 CJM

Domingo 22.08.2010 / 05:34

$TAR ( e-mail: )
Sábado 21.08.2010 / 21:08
porque piensan que es malo que la gente este pidiendo un alto a la violencia? mejor educate porque el pobre eres tu porque no sabes deletrear meaning you suck dumbass quick to talk to shit because you are probably one of those lowlife scumbags fucking up mexico you are a fucking piece of shit die slow bitch

( e-mail: )
Sábado 21.08.2010 / 07:17

( e-mail: )
Viernes 20.08.2010 / 10:32

W O L F ( e-mail: ONLY FOR ART )
Miércoles 18.08.2010 / 10:15

VERDAD ( e-mail: A SI ES )
Miércoles 18.08.2010 / 10:03

ARVIZU ( e-mail: prmarvizuzarazua@ )
Lunes 16.08.2010 / 16:07
Q paso mis BORRACHOS? un saludo a todos mis mexcaleros y puro PRM MEXICLES.

R3D ( e-mail: )
Lunes 16.08.2010 / 07:16

( e-mail: )
Domingo 15.08.2010 / 06:45
pinchi shagy de la swk esta todo pinto como michael jacson ajja pinchi ruko kulero

Sábado 14.08.2010 / 09:55

OFA ( e-mail: NI CK )
Viernes 13.08.2010 / 12:40
saludos al compa ZONESWK Sabes esta a toda madre este viaje tuyo y del yeya nadamas que tucorreo no puedoentrar pero te apoyo dale cuerda por todas las principales YEYA ONTAS sblenle diganle que ye salio agan arte BY...NICK

OFA ( e-mail: NICK )
Viernes 13.08.2010 / 12:35

SPUNKY* WFlks ( e-mail: SPUNKY ONE )
Viernes 13.08.2010 / 05:15

OFA ( e-mail: NICK )
Jueves 12.08.2010 / 18:56

Jueves 12.08.2010 / 12:39
YA NO QUIERO VIOLENCIA EN MI CIUDAD!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! QUIERO PAZ!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! POR EL AMOR DE DIOS YA PAREN CON TODA ESTA VIOLENCIA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

BY FACERONE ( e-mail: FACE------ACI-CREW )
Miércoles 11.08.2010 / 09:35

OSK ( e-mail: )
Miércoles 11.08.2010 / 05:41

SECK ( e-mail: BCL )
Miércoles 11.08.2010 / 05:36

SECK ( e-mail: )
Miércoles 11.08.2010 / 05:26

CROMO ( e-mail: CROMO )
Miércoles 11.08.2010 / 05:20

OFA ( e-mail: NICK )
Martes 10.08.2010 / 17:23

face-----one--aci ( e-mail: FACERONER--------- )
Martes 10.08.2010 / 08:49
orale ps aki esta the face------one----aci crew ok adekorar la ciudad ok todas las crews de juaritos city

Lunes 09.08.2010 / 07:54

SWK ( e-mail: YEYA )
Lunes 09.08.2010 / 05:36

FACER ( e-mail: FACERONE--------- )
Domingo 08.08.2010 / 13:34

YO ( e-mail: )
Domingo 08.08.2010 / 08:38

( e-mail: KLEEEEEN BJL )
Sábado 07.08.2010 / 12:40

( e-mail: )
Sábado 07.08.2010 / 07:10

( e-mail: )
Sábado 07.08.2010 / 07:06

SWK SONE ( e-mail: )
Viernes 06.08.2010 / 16:35

Viernes 06.08.2010 / 16:31

bone ( e-mail: )
Viernes 06.08.2010 / 11:11

SHAGY WF1 ( e-mail: )
Viernes 06.08.2010 / 05:53
arre we mejor para torikear chida we ai esta mi msg agregame y para ber como korre el agua sone y ponernos de akuerdo ok de rato

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 13:08

SHAGYMAN ( e-mail: )
Jueves 05.08.2010 / 12:27

FACER ACI CREW ( e-mail: )
Jueves 05.08.2010 / 12:04

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 11:04

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 10:52

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 10:45

SHAGYMaN ( e-mail: )
Jueves 05.08.2010 / 09:13

Jueves 05.08.2010 / 08:33

swk sone ( e-mail: )
Jueves 05.08.2010 / 08:19
que transa my yeya soy el sone de la swk melchor barreal si bes esto nomas escribe cuando quieres ir a pintar y enque lugar tambien dime en donde nos podemos ber pa planear lo de la pinta alcabo yo tambien tengo unos botesillos chido.........

SW ( e-mail: YEYA )
Miércoles 04.08.2010 / 18:11
JUAREZ PAZ JUAREZPAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ INVITO A TODOS LOS ARTISTAS A QUE LO HAGAN SOLAMENTE ARTE oooooooooooooooooooooo miciudad sin violencia de acuerdo y si no tienen para latas vamos aciendolas pero para que no siga esta crueldad vamos a rebelarnos con arte como lo sabemos acer te espero YEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYA

SWK ( e-mail: YEYA )
Miércoles 04.08.2010 / 18:06
tengo 15 anos sin hacer arte saludos al wild ´´shore´´ de lo ylc al compa duelo yck o kakos 90 del tec. mis respetos .......OTK......... que onda te pongo 70 puntos en una noche sin pleito y sin problemas solamente vamos a darle sin mentarlos la madre arre PERO QUE DIGA JUAREZ PAZ ...JUAREZ PAZ....JUAREZ PAZ. arre notificalo antes del 8 de agosto YEYA,,SWK.

swk ( e-mail: yeya )
Miércoles 04.08.2010 / 17:59
hey SWK sorounnd wont krylon de los mores trece gente km 14 no mientas si eres swk me sobra una caja de crylon vamos a darle escoge la tecnologico ola casas grandes pero sin crue vamos a poner arte como la vez le entras o te quedas fuera

2ac ( e-mail: )
Miércoles 04.08.2010 / 16:35

FACERONE ( e-mail: )
Miércoles 04.08.2010 / 06:00

world five one wf1 ( e-mail: )
Martes 03.08.2010 / 15:54
aki los wf1 de tierra nueba ok dejando huella somos bien alegres jejeje

Martes 03.08.2010 / 10:20

foztheroner ( e-mail: )
Martes 03.08.2010 / 08:10
ee weyes denselos de frente ii no ande de mamones escribiiendosee sii tan hombrezz son denselos dee frente pinzhiss vatos puñetass!!!!!!

mr.fozther ( e-mail: a chinguen asu madre )
Martes 03.08.2010 / 08:06
qee tranzaa aqii el foztheronerr homiss de la ck4 rifando todo el mundoo pa toda la bola de naqeettes puñetass H... uen asuu madree

BY FACE ( e-mail: )
Martes 03.08.2010 / 06:14

SHAGYMAN ( e-mail: )
Lunes 02.08.2010 / 17:27

Lunes 02.08.2010 / 11:18

CROMO ( e-mail: CROMO )
Lunes 02.08.2010 / 06:27

FACER ( e-mail: )
Domingo 01.08.2010 / 18:47

( e-mail: )
Domingo 01.08.2010 / 18:44

( e-mail: )
Domingo 01.08.2010 / 18:37

HeLio!pb7! ( e-mail: )
Domingo 01.08.2010 / 18:26
jaja les digo qomo nos MAMAN sigan levantando el barrio pinshis JAROSHOS! BARRIO SIETE QOSHA!

pb7! ( e-mail: )
Domingo 01.08.2010 / 13:06

pb7! ( e-mail: )
Domingo 01.08.2010 / 12:53

Domingo 01.08.2010 / 10:03

HeLio! pb7! ( e-mail: )
Sábado 31.07.2010 / 18:12
sigan mamandonos weiies :D BARRIO SIETE LOQOS!

Barrio7 ( e-mail: )
Sábado 31.07.2010 / 16:45

ariel ( e-mail: )
Sábado 31.07.2010 / 15:07
hey canvienn por que hay personas a suss alrededores que los ha tratado de ayudarles haganlo canvien canvien por que estoy cercaaaaaa hijs mios hagan caso dejen las malas amistades lean alal bivlia leanla acerquesense a dios jehova dice ayuta que y te ayudare

jose ( e-mail: )
Sábado 31.07.2010 / 15:03
hola juarensess que como estan canvien sus vidas por que dios esta cerca de ustedes y va a llegar su dia de juicio contra el canvien sus vidas haganlo por sus familias estoy muy cerca de ustedes haganlo busquen ayuda espiritual

KLEEEN BJL ( e-mail: )
Sábado 31.07.2010 / 12:00

FACER ( e-mail: )
Viernes 30.07.2010 / 18:19

SHAGYSOTE ( e-mail: )
Viernes 30.07.2010 / 18:11

Viernes 30.07.2010 / 15:47
un saludote pa los msf y los wf de parte del sone dela swk msr crew melchor barreal y pa todos los grafers de juaritoz city

Viernes 30.07.2010 / 15:43
cual pinche fama P... el sone de la swk msr crew melchor barreal te cocha puto...............

BJL KLEEN ( e-mail: )
Viernes 30.07.2010 / 11:36

Viernes 30.07.2010 / 10:53

cnccruu!! ( e-mail: )
Viernes 30.07.2010 / 07:35
saludos a toda la bola de graffiteros de juaritos yeeeppaaa a esa gente q se la rifa por las alturas falta mas taggs i bombones x la cityy ai andamos CRIMINALCAPS.... CNC CREW FRESHK!JOWER-nert:P chido banda:)

BJL KLEENS ( e-mail: )
Viernes 30.07.2010 / 06:38

SHAGY ( e-mail: )
Viernes 30.07.2010 / 04:57

Jueves 29.07.2010 / 19:13
SONE SWK MSR CREW.MELCHOR BARREAl saludote pa los msf al die.drase y atoda su gente cuando nos vayamos aventar esas lineas en la jilotepek tachamos alos pinches ks crew porke esos putos me ensimaron y tambien cuado vayan por el puenta del desnivel rumbo para yr al centro tuersan unas lineas que tacharon los pinches sc . fijense elos dos lados del puente asi estamos apuntados swk sone.bokal.defk chido................

Jueves 29.07.2010 / 18:59

sone swk ( e-mail: SWKZONEERICK )
Jueves 29.07.2010 / 18:42

sone swk ( e-mail: swkzoneerick )
Jueves 29.07.2010 / 18:37

FACER ( e-mail: )
Jueves 29.07.2010 / 10:10

( e-mail: )
Jueves 29.07.2010 / 07:06

Miércoles 28.07.2010 / 15:16

Miércoles 28.07.2010 / 15:06

sone swk ( e-mail: swk zoneerick@hotmail .com )
Miércoles 28.07.2010 / 14:58

( e-mail: )
Miércoles 28.07.2010 / 08:29
crooomoo seuuzz.. 87 rifan

the fiky ( e-mail: FiiQky )
Miércoles 28.07.2010 / 08:12
in memory of foowee.. tartaa dee loz 38 aqii ztamozz pa lo qe seaa homyss ooraa adeoozz 87 riifa ...

The FiQkyOner ( e-mail: FiiQky )
Miércoles 28.07.2010 / 08:09
qe tranzaa ppzzz aqii laa FiiQky, Qeezhhyy, miiss, CrooomoO ,Seeuuss,Foowee,Kooruu,87 mihoozz..9829

SHAGYONER ( e-mail: )
Martes 27.07.2010 / 10:23

KLEEN BJL ( e-mail: )
Lunes 26.07.2010 / 08:14

CROMO ( e-mail: SEUS )
Lunes 26.07.2010 / 05:18

( e-mail: )
Domingo 25.07.2010 / 14:37
H... uen a su P... madre pinches jarudos o mejor jarochos jajajaja seguro son puros pinches tierrosos dan verguenza se deven de llamar jarochos mejor jajajaja P...

sckot ( e-mail: )
Domingo 25.07.2010 / 12:49
aki el sckot rifando komo siempre de los 725 crew ft m.e saludos a todos los pcl lokos del roma el sckot rrrrrrrrrrrriiiiiiiiiiiiiiifffffffffffffaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

SHAGYONER ( e-mail: )
Sábado 24.07.2010 / 09:38

fose ( e-mail: )
Viernes 23.07.2010 / 06:47
el fose*cope-snak*grove*kause*cabe*skyw*gogo*chorizo*jaico* y todos los que faltan *b/dukesotes30/ws. rip mocko*cebollas* dukes30 firman

fose ( e-mail: )
Viernes 23.07.2010 / 06:43
un saludo para todos los lokos de los dukes 30 ws el fose rifa

SHAGYMAN ( e-mail: )
Viernes 23.07.2010 / 05:07

( e-mail: )
Jueves 22.07.2010 / 16:03
jajajajaja que risa dan los doblados lesva cargar la V... putos jajajaja tambien pa ustedes tenemos V... putos ahora si venimos con todo esta es nuestra sona los vamos a desapareser jajajajaaajculooooooooossss

KLEEN BJ L ( e-mail: )
Jueves 22.07.2010 / 13:51

CROMO ( e-mail: BAMBA 87 )
Jueves 22.07.2010 / 05:13

drex ( e-mail: jarudotezz )
Miércoles 21.07.2010 / 12:20
jaja q rollo mi jente del barrio un saludo pa mi carnal klen.. y ai tamos mi yesk ...arres mi wf1 de tierra new ai tamos mi shagi conectandola are jarudollks bjlbp el drex see los cosha a esos pinshis entrados q estan bien cahados neta x q tiran tanto rollo si bien sabes como corre el agua con los d jarduo nosotros no estamos para mamaditas como ustedes neta q son pura perdida d tiempo bueno sigas de abladores culitos de M... jaja ... bario jarduo lokos y nomas

( e-mail: )
Miércoles 21.07.2010 / 04:52

by fobya ( e-mail: )
Martes 20.07.2010 / 20:05

( e-mail: )
Martes 20.07.2010 / 12:11

185 ( e-mail: )
Martes 20.07.2010 / 06:31

PRM ( e-mail: MEXICLES )
Martes 20.07.2010 / 06:26

LA CUESTA ( e-mail: XXX )
Martes 20.07.2010 / 06:16

( e-mail: )
Lunes 19.07.2010 / 13:18

""""""""""" ( e-mail: )
Lunes 19.07.2010 / 06:48

yo ( e-mail: )
Domingo 18.07.2010 / 08:32
son culos todosss el duet de jarudo sholos

( e-mail: )
Sábado 17.07.2010 / 16:23

( e-mail: )
Sábado 17.07.2010 / 16:19

( e-mail: )
Sábado 17.07.2010 / 12:41
H... uen a su P... madre pinches jarudos pinche barrio cagado dan verguensa a ustds quien los conose solo su P... madre jajajaja pinches tierrosos dan verguensa que sean de juarez nos queman a todo juaritos cambien de nombre P... jarochos

( e-mail: )
Viernes 16.07.2010 / 21:20

FACE ( e-mail: )
Viernes 16.07.2010 / 18:21

FACE ( e-mail: )
Viernes 16.07.2010 / 18:09

El Padre de Todos ( e-mail: )
Viernes 16.07.2010 / 17:40
pinches grafiteros C... cholos pedorros! Rayense las nalgas mejor putos! Que andar rayando ahi pinches letras pendejas. Ponganse a escribir mejor el abecedario! Pinches mermas!

FAMA FAMOSO ( e-mail: )
Jueves 15.07.2010 / 10:00

WORLD FIVE WF1 ( e-mail: )
Jueves 15.07.2010 / 09:49

( e-mail: )
Jueves 15.07.2010 / 05:39

SHAGY ( e-mail: )
Miércoles 14.07.2010 / 18:54

FAMOSO ( e-mail: )
Miércoles 14.07.2010 / 18:45

( e-mail: )
Miércoles 14.07.2010 / 14:30
pinche bola de kulos x ke no se lo dicen en la cara x ke en puras letriyas ya no la mamen ya densen en la madre no valen V... putos

pokerONE ( e-mail: )
Miércoles 14.07.2010 / 10:17
barrio pelones uno rifa putos elo snokeroner y el pokeroner rifan putos toda la citi la colosio rifa

xxxxxxxxxxx ( e-mail: xxxxxxxxxxxxxxxxxx )
Miércoles 14.07.2010 / 08:16

KLEEN LOKO BJL ( e-mail: )
Martes 13.07.2010 / 13:23

HeliO! ( e-mail: PB7 )
Martes 13.07.2010 / 11:44
jajaja qomo ME MAMAAN weies neta iia sta esqriben qosas x mii jaja asi siganLe weies :D qomo saben qe siempre an sido de aguuota! jaja me la peeLan! Helio PB7!

jarudos ( e-mail: )
Martes 13.07.2010 / 11:01
arres arres simon tiren su rollo cagado .. tu k elio estas bien cagadot neta q das bergunsa neta tu q we acien shingas bas andar aciendo de awa si asta tu solo t das risa we jaj esmas sigas de ablador tu bien sabes q tu barrio es de awota siempre los traemos del C... en su propio barrio y no lo nieges we jaja jarudote lks bjlbprpsck se los coshan el dreex

bjl ( e-mail: )
Martes 13.07.2010 / 10:24

helio PB7 ( e-mail: )
Martes 13.07.2010 / 10:16

( e-mail: )
Lunes 12.07.2010 / 04:21
sstk surenos dela zaragoza rifando komo siempre

( e-mail: )
Domingo 11.07.2010 / 11:33

oscar ( e-mail: )
Sábado 10.07.2010 / 09:19
que rollo a todos los cholos papasotes ps aka dejo mi mns para que me agregen : estoe guapo y mamado. arre un cholito guapo agrege

SeEs ( e-mail: )
Sábado 10.07.2010 / 09:13
qe pedo rasa a quien le gusta el graffiti y el break dance agrege pd: no agregan nomas por mamar Eh!

trane ( e-mail: )
Viernes 09.07.2010 / 12:04
mi barrio es el k rifa bsp

Viernes 09.07.2010 / 06:53

Viernes 09.07.2010 / 06:44

PBS! ( e-mail: )
Jueves 08.07.2010 / 17:28

jenni y amigas ( e-mail: mera clase )
Jueves 08.07.2010 / 15:34
rip rapto de mera clase neta rapiavas bien chido ya no es lo mismo sinti ke empazz descanses de rato nos vemos rip raaptoo mera clasee rip adriann

ldye ( e-mail: bodyshop )
Miércoles 07.07.2010 / 04:21
apoyanos motoclub amigos cuando nos mires puedes pararnos para que te tomes unas fotos .puedes unirte teniendo tomo moto club amigos vamos por el 5 aniversario esta pendiente en nuestra pagina interesante asi que si te gusta la adrenalina en dos ruedas unete y contactanos ,,,shopper´s,deportiva,mini´s,extravagantes,echisas,performance, acompananos proximamente en toda la ciudad apoyando la paz por juarez QUINTO ANIVERSARIO pitanos saludanos continuaremos hermitaños del asfalto AMIGOSCLUB BY´´VICTOR ORGULLO JUARENZE

PBS! ( e-mail: )
Martes 06.07.2010 / 11:45

( e-mail: )
Martes 06.07.2010 / 11:22

( e-mail: )
Martes 06.07.2010 / 10:57

SAL2 ( e-mail: SAL2.COM )
Lunes 05.07.2010 / 18:18

demas ( e-mail: )
Lunes 05.07.2010 / 18:02

demas ( e-mail: )
Lunes 05.07.2010 / 17:59
que pues les comento que el gobierno nuevo nos dara la oportunidad de hacer arte pues los que gusten estan invitados a participar ONLY FOR ART.

snoof oonee ( e-mail: )
Lunes 05.07.2010 / 09:54
.eeL snoof oonE.!b.jaaruudoo lookoos riifaan

( e-mail: )
Lunes 05.07.2010 / 09:42
saludos atodos los de juaritos des de laredo ttexas sstk rifando

demas ( e-mail: )
Lunes 05.07.2010 / 06:46

( e-mail: )
Domingo 04.07.2010 / 07:36

( e-mail: )
Viernes 02.07.2010 / 18:40

( e-mail: )
Viernes 02.07.2010 / 06:39
el nox puso eso de abajo pff pinche caca tu solo no eres nada pinche presumido

( e-mail: )
Jueves 01.07.2010 / 12:16

( e-mail: )
Jueves 01.07.2010 / 07:58

( e-mail: )
Jueves 01.07.2010 / 07:54
saludoss pal varrio penkiss pero loss longoss puroo choloss piratass i H... en su madre los del 4 nunca la icieronn con nosotross pinchess culoss,nomass guachaban los cuetazozz i salian corriendo pa su pinche barriecillo cagadoo...SABEN QE RAZA LOS DEL BARRIO CUATROO SON BIEN CULOTESS NETE ASI QE NO LOS TOMEN EN CUENTA A ESOS WUEYESS POR KE ESO SI SON BIEN MAMADORESS LOS CULOSS...SE LOS DISEE UN VATO DE 35 AÑOSS KE TYRABA Y TYRA VARRIO P3NKISS...SALUDOSS RAZA .:P33NK11SSS:.

??? ( e-mail: swk )
Miércoles 30.06.2010 / 18:50
ala V... kn los de la obrera pura MONTERREY X3 PUTO SWKEROTES komo la ves

( e-mail: )
Miércoles 30.06.2010 / 11:39
arriba el el barrio. veinty tresss 23 controlandoo los ceross de la colonia felipe angeless... puro nort3ño loco aki en el barrio jodido peroo bien locotess y bien truchotass puro 23 homiess pa qe guachenn el colorrr.. atentamentee el TOÑO DEL VARRIO..VEINTY TREESS V23 SALUDOSS GENTEEE....!!!!

bjl ( e-mail: )
Miércoles 30.06.2010 / 09:37

???? ( e-mail: !!!!!! )
Martes 29.06.2010 / 12:45
en memoria del señor SERGIO VEGA "EL SHAKA" que fue asesinado el pasado domingo en la ciudad de obregon sonora.... mi mas sentidi pesame a la familia del señor y que descanse en paz

( e-mail: )
Martes 29.06.2010 / 09:07

( e-mail: )
Lunes 28.06.2010 / 16:38

pato ( e-mail: )
Lunes 28.06.2010 / 14:54
lo qee me da un H... o de risa es qee siempre estan aqui los mismos weyes qee nunca salen de sus casas o ke no maaaameeeen jaja y nunca se dicen las cosas de frente malditos maricones jaja ni caminar agusto han de poder por qee diske se sienten importantes y segun ustedes muy hombresitos jaja no no ustedes si qee dan risa y luego simpre son los mismos pendejitos desde el 2007 el klen el skor el gatick los bjl y otros pendejitos jaja lo qe no es tener vida social enfermos ignorantes jaja qee los penetren por niñas si fueran muy H... ones estarian muertitos pero ps la compu los atonta

chino ( e-mail: jimmy_brian_16.@hotmail .com )
Lunes 28.06.2010 / 11:44

( e-mail: )
Lunes 28.06.2010 / 08:57
puro barrio veinti tress norteñoss controlando toda la felipe angeless gentee trucha con el toño d la 23 awueboo .........!!!!!!

martha ( e-mail: )
Lunes 28.06.2010 / 06:15
No puedo decirte el coraje q siento, me ha dolido mucho lo q hiciste, eres lo peor q conoci en mi vida, y me vengare q no te quepa la menor duda, pronto borrare esa estupida sonrisita de tu cara.

( e-mail: )
Sábado 26.06.2010 / 04:48
sshingen asu madre ESTUPIDOS MEKOS!*

( e-mail: )
Sábado 26.06.2010 / 03:35

LBPK ( e-mail: )
Viernes 25.06.2010 / 14:48

Jueves 24.06.2010 / 08:32

( e-mail: )
Miércoles 23.06.2010 / 15:22
nort sidee genteee ai tamosssss 23 lokossss norteñosss.........!!!!!!!!!!!!! el chato 23 veinti tress norte de la felipe angeless...saludoss pa todoss loss del varrio pendientesss... v23

( e-mail: )
Miércoles 23.06.2010 / 15:15

( e-mail: )
Miércoles 23.06.2010 / 15:08
ke royo mi gente del barrio veiti tress de la colonia felipe 23 cocha chabalitoss ke no se less olbidee atte el chatoo del v23

( e-mail: )
Miércoles 23.06.2010 / 14:55

bjl ( e-mail: )
Miércoles 23.06.2010 / 12:52
jajajaj esos welles de abjo q estan bien cagadotes jaja q mui mafiosos jaja no mamen ya tumbense ese rollo q unidos mafiosos jjajaaj ... la neta jarudo es mafia ustedes bien lo sabes nosotros no ablamos .. nosotros actuamos jarudo,maffia pa pa k guashe bjlokotes ..o k kieres q qede otro wei de ustedes tirado en su mismos barrio jajaja buno sigan tirand su rollo cagado d mafiosos jajajaa jarduo mafia protegido por los grandes y nomas

cangri ( e-mail: )
Miércoles 23.06.2010 / 06:23

buudaUNO ( e-mail: )
Martes 22.06.2010 / 18:50
buudaaUNO weed squuad creeww eLc

( e-mail: )
Martes 22.06.2010 / 16:59
que onda batos nomas quiero mandar un saludo alos del barrio de la once galeana y dales mi lamentable pesame adios soy el nyssy deciudad juarez

EL FLOW CIA CREW.. ( e-mail: )
Lunes 21.06.2010 / 12:53

EL FLOW CIA CREW.. ( e-mail: )
Lunes 21.06.2010 / 12:47

( e-mail: )
Lunes 21.06.2010 / 07:50
sstk sur rifa

demas ( e-mail: )
Domingo 20.06.2010 / 22:09
tengo crias baras de american pyttbulls atras del motel del rey pregunten por el de los pitbulls blancos

GRAFFTY ( e-mail: MRS@R13 )
Domingo 20.06.2010 / 22:05
Domingo 20.06.2010 / 21:57
fijate entre por casualidad andaba buscando otra informacion y que me topo con tigo que onda . MEXICAN RIGHT STYLE. lo recuerdas hace algunos anos lo hicimos en pomona y los angeles calif.cuando llegamos a el paso.tx. eramos familia de OFA. ONLY FOR ART.que coinsidencia mores trece del fraccionamiento lomas de san JOSE que tiempos haber si un dia paso por la casa de tus papis para saludarte ya tengo mi familia y me daria gusto que la conocieras te veo o nos escribimos..MRS'c'

SERCH FIRST ( e-mail: MRS/13 )
Domingo 20.06.2010 / 21:47
SALUDOS!!!! A TODOS SI SABEN QUIEN ES MI COMPA EL QUE ESCRIBE QUE TIREN KONTROL?Es un cuate que le gusta el arte del graffty,pero no lo expresa danando la barda del vecino ni la iglesia a este cuate le gustaba subirse a los anuncios de a50 60mts de altura que condo latas de krylon hace un buen diseno y baja y le toma fotos no se droga ni consume lcohol mucha gente loconoce de la cuesta hasta lomas de san jose pero no le gusta meterse en lios de ninas solamente cuando hay que..el estudio en al 15 ahora este compa le gusta dar buenos del barrio MORES 13 en san.JOSE. MR.SEARCH !1!

GRAFFTY ( e-mail: MRS@R13 )
Domingo 20.06.2010 / 21:35

demas ( e-mail: )
Domingo 20.06.2010 / 21:27
mejor en vez de poner tantas mmmdas por que mejor no inventan algo para que esto cambie en cd.juarez atras de los vitrales km14san.JOSE.SIN OFENDER A gusta el arte nosotros ganamos el concurso de graff.frente al 128..

( e-mail: )
Domingo 20.06.2010 / 10:23
J A R U D O !*

( e-mail: )
Sábado 19.06.2010 / 15:48
B.LKS MC.K rifan

( e-mail: )
Sábado 19.06.2010 / 05:50
j a r u d o

( e-mail: )
Viernes 18.06.2010 / 11:05

( ( e-mail: )
Viernes 18.06.2010 / 11:04

( e-mail: )
Viernes 18.06.2010 / 11:01
un saludo para la MIIIISSSSSSS(K)

( e-mail: )
Jueves 17.06.2010 / 15:41
na vallase a la V... culero

( e-mail: )
Jueves 17.06.2010 / 11:09
desen a konocer kon eshos mekos! nopor INTERNET! aeesta el EJEMPLO: el JARUDO!+_

( e-mail: )
Miércoles 16.06.2010 / 14:35
na nadie rifa solamente el cindicato criminal putos

( e-mail: )
Miércoles 16.06.2010 / 13:12
los piinches b.lks riifan ii controlan lokotes mc. puuthos

( e-mail: )
Miércoles 16.06.2010 / 12:52
yoooo soi lalo la leonaa i rifoooooo

( e-mail: )
Miércoles 16.06.2010 / 07:35

( e-mail: )
Miércoles 16.06.2010 / 07:32

( e-mail: )
Martes 15.06.2010 / 22:13
na ya se deverian ir a la V... todos pelienc a putasos no a palabras pinchi chavalas sindicato criminal rifa y controla putos north side locos 18 altavistota putos

( e-mail: )
Martes 15.06.2010 / 16:52
doblee a

( e-mail: )
Martes 15.06.2010 / 14:51
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

thee dooblee a ( e-mail: )
Martes 15.06.2010 / 14:18
thee dooblee a lokos

( e-mail: )
Martes 15.06.2010 / 11:26

( e-mail: )
Martes 15.06.2010 / 10:27
dooobleeee aaaaaaaaaaaaaaaaaaaaaaa

thee doblee a ( e-mail: )
Martes 15.06.2010 / 09:55
Riip*soow*tiibu*ikeeer*chooree*hulk* doooblee a viiivee putoos

( e-mail: )
Martes 15.06.2010 / 09:47
doooblee a

skoR! JARUDO LOKOS! ( e-mail: )
Martes 15.06.2010 / 06:40

thee dooblee a ( e-mail: )
Lunes 14.06.2010 / 17:59
loos dooblee a puutoos

( e-mail: )
Lunes 14.06.2010 / 11:01
somos puros north side locotes putos a la vrga los surenos pura chavala

skin ( e-mail: el skinsote )
Lunes 14.06.2010 / 10:52
que transa putos un saludo a todos los del barrio sindicato criminal rifa putos y que se ballan a la V... todos los entrados C... nosotros rifamos putos a la V... los de la quinta lomo pura pinchi chavala

( e-mail: )
Domingo 13.06.2010 / 22:31
QiubooLee qe pinchi tRannzaa aki laa pincHi MAFIA UNIDA KRIMINAL reportandoocee y aLa vergaa koon looz pinchiiz jarochooz dee mieRdaa qe no vaaLen veeRgaa

( e-mail: )
Domingo 13.06.2010 / 22:21
meebaaboosHaa teeAMOO comoo noo tee looo imaagiinaaz kuaantoo eRez el amoR de mi viidaa teeAMOO nunkaa lo olvideez

cecilia y juan k ( e-mail: cecilia_salinas40 )
Domingo 13.06.2010 / 14:42
no pzz aki estrenando pa ver k onda kiss a to2

carlos ( e-mail: )
Domingo 13.06.2010 / 11:34
sueno te amo me acuerdo de todo lo k emos paasado juntos eers lo mejoor tee amoo kiero esstar coon tijoo ya desiidete amor

( e-mail: )
Domingo 13.06.2010 / 06:12
pues lavd! nomas la P... rpscreww! le sale por el pinchi jarudo! unok otro dela lbp!

EL FLOW ( e-mail: )
Sábado 12.06.2010 / 22:22

( e-mail: )
Sábado 12.06.2010 / 21:36

( e-mail: )
Sábado 12.06.2010 / 10:35
fuck the facking jarudos hahahaha fuckings pussys im the @cme one mex side kings fuckers forever and 4 life the @cme 4 ever msk galeana

EL FLOW ( e-mail: )
Sábado 12.06.2010 / 10:30

( e-mail: )
Sábado 12.06.2010 / 10:24
unidotez 14 hijoz de su P... madre pinchiz jarochaaz komo tiran kaka neta weyez dan verguenzaa pinchi boLaa de jarochaz mejor pongance acer aLgo x la patRiaa weyez netaa noz peLan la veRgaa weYeez jaja Kulonez son tan kuLoz qe ni entRan a nueztRo baaRRioo x saben biien qee si entRan loz vamoz adeztrozar a cuetazoz Pinchi bola de maRikonez MAFIA UNIDA KRIMINAL 656 ASESINOS PEBEU 14

( e-mail: mafiajarudo )
Viernes 11.06.2010 / 14:23

sckot ( e-mail: )
Viernes 11.06.2010 / 14:12
aki el sckot para todos pclcrew q rifan en el roma y en la divi el sckot kocha

dwocker ( e-mail: )
Viernes 11.06.2010 / 10:12
ke rollo les mandan saludos a todos los graffiteros d parte d los mtvk

Gloria ( e-mail: )
Viernes 11.06.2010 / 05:37
Y bien, ya el tiempo esta pasando, tengo q segui soportandote, anoche tuve q ceder y fue asqueroso, no sabes q asco me das ya, parece mentira e un dia te ame mas q a nada en el mundo...le doy gracias a dios por ya no sentir nada por ti...eres de lo peor...

r3d ( e-mail: )
Jueves 10.06.2010 / 15:30
ke rollote aki reportandose el RED de los CLK 90'S PURO INFO TEK LOS KAKOTES............

( e-mail: )
Jueves 10.06.2010 / 11:26

( e-mail: )
Miércoles 09.06.2010 / 20:10

( e-mail: )
Miércoles 09.06.2010 / 20:04
barrioo 23 cocha....!!

( e-mail: )
Miércoles 09.06.2010 / 19:41

( e-mail: )
Miércoles 09.06.2010 / 19:34

TAPIAS13 cangry ( e-mail: )
Lunes 07.06.2010 / 21:06

( e-mail: )
Lunes 07.06.2010 / 18:38

( e-mail: )
Lunes 07.06.2010 / 18:32

SISMO ( e-mail: )
Lunes 07.06.2010 / 18:24

elpinchecobra ( e-mail: )
Domingo 06.06.2010 / 10:59
que tranza putos saken un toque el `pinche cobra de los greenside cocha putos splch*

STOP ( e-mail: )
Domingo 06.06.2010 / 10:56
EL Stooop viejo bjl jarudo loko el cobra yel mago y la pipol arre jarudo loko cocha

Sábado 05.06.2010 / 15:35

BJLOKOS ( e-mail: )
Viernes 04.06.2010 / 10:35

Taylem ( e-mail: )
Jueves 03.06.2010 / 15:06
DaaiiLy uNiiKoTaa miiJJas

( e-mail: )
Jueves 03.06.2010 / 12:59
jaja pos chido solo qiero desir qee thee amo0 mucho0 karin y syy piensas qee soyy perla pues te ekivokas mucho0 soyy tu novia denizz posdata thee amo0 muxooo no lo olvidezz

( e-mail: )
Jueves 03.06.2010 / 12:54

( e-mail: )
Miércoles 02.06.2010 / 12:45
" sofeker "

( e-mail: )
Miércoles 02.06.2010 / 12:38
sofeker and lamyoner

( e-mail: )
Miércoles 02.06.2010 / 11:05

the axerone 727 ( e-mail: )
Miércoles 02.06.2010 / 10:27
ke rollo aki el axerone del barrio siete de la cuesta dejando un saludo a los vale V... de los jarudos ke el sabado nos pelaaron la V... aunke le andubieran mamando los huevos a los dandis hay hay bien chavalotas barrio jarudo dandis 30 jajajajaja no mamen weyes neta ke son de awua aunke se unan kon kien se unan nomas ke ustedes ya nos tienen asta la V... ya asata aburren ya nadie les hace caso pinchis mokosos de 12 anos no valen V... neta

sckot ( e-mail: )
Miércoles 02.06.2010 / 09:36
aki dejando saludos para los pclokos el esckot rifa 725crew kontrol y el ysto sigue graffitiando y al snopy kuidese karnal

( e-mail: )
Miércoles 02.06.2010 / 07:18

( e-mail: )
Miércoles 02.06.2010 / 06:57

( e-mail: jarudo! )
Miércoles 02.06.2010 / 03:47
puro BLABLABLA! &nada de acccionn JAJA! pinnchimediokres nommas saben lebantar su barrio porestaa PAGINA! ono? jajajaaj! pinnchis estupidosss osikoness noosotros si estamos en kualkierr LADO enkualkier LUGAR! &noes mentiraa. & algunos iasaben. komosomos MARRANITOS! kaiganle al barrrio ABE5RSI ESVD KE LAKUAJAN!

world ( e-mail: )
Martes 01.06.2010 / 16:22
ke lastima me da ver en lo ke se comvirtio mi crew ask despues de catorse abriles el plan era de puro graffiti y no de una pandilla ya estoy grande y tengo hijos pero si pudiera regresar el tiempo no aria ask crew atte. world y el nerf

( e-mail: )
Martes 01.06.2010 / 12:07

( e-mail: )
Martes 01.06.2010 / 07:47

Martes 01.06.2010 / 07:42

( e-mail: )
Martes 01.06.2010 / 03:45

( e-mail: )
Lunes 31.05.2010 / 18:11

( e-mail: )
Lunes 31.05.2010 / 15:50

Lunes 31.05.2010 / 11:38

( e-mail: )
Lunes 31.05.2010 / 06:25

( e-mail: )
Viernes 28.05.2010 / 19:48
jarudo locoss de porr vida,.... aki es mi barrio, y aki esta mi gente,... nos la pelan todoss culeross puro b.j.l... SUR3ÑOS X3...JARUDO LOCOSSUR 13

( e-mail: )
Viernes 28.05.2010 / 12:21
jarudote lokos putos se los cocha a todos lbp creew atte el 4 letras

( e-mail: )
Jueves 27.05.2010 / 09:30

( e-mail: )
Miércoles 26.05.2010 / 17:49
los de sstk son culoss yo soi de los jarudo locoss,,y sy mui vergass ps kaiganle al barrio aki estamoss en lacuesta somos muchos y bien locoss puutos panochass..

sstk ( e-mail: )
Miércoles 26.05.2010 / 15:04
ya dejense de M... bola de P... sstk sureñotes se la rifa ak en zaragoza y x todo juarez pinches culotess

( e-mail: )
Martes 25.05.2010 / 13:15
eel doobllee a lookoos

( e-mail: )
Martes 25.05.2010 / 09:07

( e-mail: )
Martes 25.05.2010 / 08:59

FLOW RABIKER ( e-mail: )
Martes 25.05.2010 / 08:21

Martes 25.05.2010 / 08:16

Sl3ck----------- ( e-mail: )
Martes 25.05.2010 / 08:05

CASPER ( e-mail: )
Martes 25.05.2010 / 07:59

meer ( e-mail: )
Lunes 24.05.2010 / 22:28
Que hay pasenle a ver. Graffiti pasenlee pasenle cdas union creeew

( e-mail: )
Sábado 22.05.2010 / 11:35

mr criminal ( e-mail: )
Viernes 21.05.2010 / 15:41
barrio norteños rifa. joma lo mejor a escuchar en cd juarez 14 656 915 controlando

joma ( e-mail: )
Viernes 21.05.2010 / 15:37
norteños rifa. el joma proximo rapero de cd juares esperen mir rimas. vato 14 656 lokotes

LA NUEVA CAMADA ( e-mail: )
Viernes 21.05.2010 / 08:56

fL0w ( e-mail: )
Viernes 21.05.2010 / 08:49
PURO SKC CUEsTOta LOKOs 87 fALcons 13 TRistEsot 21 EL FLOW EL CHINo EL mUñeKa 915 asTa la 656 rIfaNDOla

EL fLo0w ( e-mail: )
Viernes 21.05.2010 / 08:43

( e-mail: )
Jueves 20.05.2010 / 13:02
para el azteca no mame we por jente nefasta como tu esta asi cd juarez k pinshe roio trampan trensandose por un territorio k ni es de ustedes maman putos

( e-mail: )
Jueves 20.05.2010 / 12:53
entonces para q estas alegando pinshe marrano de M... cual pinshe lomero wey no mame si todos los culos de los aztecas son unos pinshes tekatos de M... te guzte o no el doble a es la neta i yo no ando de mamador pork io le salto por mi barrio i la neta no por k anden meniados a mi esos pinshes roios no me entonan pero somos la neta el doble a puto

( e-mail: )
Jueves 20.05.2010 / 11:47
q transa jent ai tamos jarudolokotes ya se la saben ai estamos bien puestotes pa lo q gusten saludos a las klicas unidas jarudo lksotes lbjlbp coshandot drex

ken ( e-mail: )
Jueves 20.05.2010 / 11:13
ke rollo gente de cd juarez los saluda el ken de amc desde reynosa tam como esta juaritos alguien de aac que tenga correo pa cotorrear

( e-mail: )
Jueves 20.05.2010 / 05:29

( e-mail: )
Miércoles 19.05.2010 / 16:15
jajja no cabe duda que son una vola de mugrosos lambepitos jajajaa nunka an vlido V... pinches titeres dises que son la mera V... jajaja alrato te tumban y qee?? sigues siendo la mera V... ? entiendan pinches titeres aqi en juares se la pelan...jaja doblados mugroosos, lomeros lambepitos jaja se creen muy vergas porqe matan y andan fajados y les pagan 5 milpesos o menos jajaja

( e-mail: )
Miércoles 19.05.2010 / 16:09
dooblee a lokos

2ac lks ( e-mail: )
Miércoles 19.05.2010 / 16:03
barretee ala veerga pinshee trensudoo de mieerda akii somoos la meera veerga eel dooblee a putoos

( e-mail: )
Miércoles 19.05.2010 / 14:24
aki en juarez rifan los AZTECAS...PURO CARTEL DE JUAREZ..PINCHESS 2A LAMBE HUEBOS...y saben ke chavalas el pez por su propia boca muere no le busken pinches pokiteros

( e-mail: )
Miércoles 19.05.2010 / 11:16
lanetaa pinnchiss estupidoss ni unodeloss doss laaarmma'jajaaj!ablaan porablarr.haha secreenmuii meniaditoss.'pendejoss nomas porkee jalan mota JAJAJAAJAJAJAJA.-oporke lleban una calaka de seguto JAJAJAJA! pinchis muertos de ambre ESTUPIDOS'

2ac ( e-mail: artistotas )
Martes 18.05.2010 / 14:18
pa el wei ese k dijop Qee loos doble a somos titeres mas titere P... es tu madre k la ponen komo kieren pinxe mokoso kulo sii kulero no asemos ni madres para k juarez este mejor pinxes alineados no valen V... kulero i hual k tu pinxe okoso meko atte doble aa

daniieel aac ( e-mail: )
Martes 18.05.2010 / 12:24
el doble a lokos putos

daniel aac lokos ( e-mail: )
Martes 18.05.2010 / 12:19
para el pendejoo k pusoo q los dobledos somos titeres no mame we de perdis ponga quien es pinshe mokoso C... no sabe ni q roio ablas por k tienes lengua C... i aunq no te guzte el doble a rifa aqui y en tu pinshe barrio pedorro P... de M...

elalexonek ( e-mail: )
Martes 18.05.2010 / 09:36
keroyote lla llego el alexonek e pasamndo a degar una pinche rrallota aaaa gaga ora pues */*/*/*/*/el ALEX one*/*/*/*/

el clow ( e-mail: )
Martes 18.05.2010 / 06:30
los terrenotes trece rifan y controlan la heroes de la revolucion. somos pocos pero locos aqui estamos y no nos vamos terrenos trece estes donde estes aqui rifa el uno y el tres

( e-mail: )
Domingo 16.05.2010 / 20:10
yop se qien es el drack y es un lepe penddejo cree qe por tirar doblado nadie le ase nada pero es pinchhe mokoso mejor ni lo pelen aaaa ylos doblados alrato cain ya saven qe son una bola de mugrosos lambepitos , enves de meterle al toro por nuestra ciudad andan de chapetes por una miseria de dinero porqe ni eso les pagan bien y ya saven qe el gusto les dura poco, mientras los train de titeres penddejoss

( e-mail: mafiajarudo )
Sábado 15.05.2010 / 09:05

( e-mail: )
Sábado 15.05.2010 / 07:12
mex side kings forever and 4 life the gansters number one of the world mexicans 4 life by 3l @cm3 675

la vero doble a muni ( e-mail: )
Sábado 15.05.2010 / 07:11
la vero de los doble a lokos

( e-mail: )
Viernes 14.05.2010 / 12:14
el doble a putoos

( e-mail: )
Viernes 14.05.2010 / 12:05
barranse ala V... putos el doble a lokos jajajaj si les cala ni pedo

ken ( e-mail: )
Jueves 13.05.2010 / 20:19
alguien que me conteste que sea vergas en aac

ken ( e-mail: )
Jueves 13.05.2010 / 19:58

( e-mail: mafiajaruo )
Jueves 13.05.2010 / 16:03
asies wei nomas abla el pinchi lepe pendejo.asta kese kede sin cabeza el meko!

( e-mail: mafiajarudo' )
Jueves 13.05.2010 / 15:58
lanetta weii te daree unkonsejoweii NOABRASEL OSIKO pinchipeerroo'ketepuuedes MIRIR entinddes wei ami nadda me kuestaa irr a buscartee atu barrioweii & lebantarte &mocharte la cabeza nomames noables PENDEJO. okierss bersufrir ATUMAMA! P... aggarre laonnda'pinnchi LOMEROTONTO'

( e-mail: )
Jueves 13.05.2010 / 15:39

( e-mail: )
Jueves 13.05.2010 / 12:29
k weyes ami me bale berga sy estas aki o no we no bales berga pinchi mierdas jarudo lokos te kocha aty atu jefa idiota de M... .. la k ago diario k te KALO OKE .. PINCHIS MEKOS de los swkuloooooooootes. de M... JARUDO LOKOS OK HOMS

( e-mail: )
Jueves 13.05.2010 / 08:13

DRACK_113 LOKOS ( e-mail: )
Jueves 13.05.2010 / 01:58

( e-mail: )
Miércoles 12.05.2010 / 20:01
como tiran royo puttos .. yo soi del jarudo yyy queeee???? no tiren su royo y derato arre al topon vemos el color bola pinchiis lomeros..

yohana ( e-mail: )
Miércoles 12.05.2010 / 12:27
Hola! barrio pesado un saludo de los primos k son la mera ley aca y los k no crean k se fijen les escribe la mas buena de las viegas la you!!! o mejor conocida como la pomo saludos especiales para la ligas, la chupones, el pikus, el burrro, para mi amorsote el macuin bueno a todos las banditas de aca los mas conocitos los biolines, los porros, los kakinos y muchos mas a y pa las nenas k H... en a su madre en serio bueno adios asta pronto. atte: LA POMOO!

SUENOKER ( e-mail: SUENOkerone )
Martes 11.05.2010 / 16:56

( e-mail: )
Martes 11.05.2010 / 16:51

ARVIZU ( e-mail: )
Martes 11.05.2010 / 15:24
BORRACHO d x vida puro PRM pa lo q gusten.tu diras?

( e-mail: )
Martes 11.05.2010 / 13:24
k H... ados kieren swk kiere k balaga berga kieren k akabemos con los tres weyes k kedan y dos no le sale jajaja no poes no se k ehingados kieren pinchis drogaditos de M... jarudo LOKOS TE KOCHA A UNO POR UNO

brian zoto aguilar ( e-mail: )
Martes 11.05.2010 / 13:23
k tranza k paza aki el senck de oriza veracruz de juarez se fue y asta aca ando soy del barrio delos vagos 1 y de la kmt ns locotes

ARVIZU ( e-mail: )
Martes 11.05.2010 / 12:42
claro q existemos P... y somos muchos para q no le hagas al wey.puro MEXICLES PRM

alineados ( e-mail: )
Martes 11.05.2010 / 11:26
kalmate mexikles todavia existen jajajajjaa?

Martes 11.05.2010 / 11:13

Martes 11.05.2010 / 11:09
77777777 2222222 555555555 7 2 5 7 222222 55555555 CREW STYLE STREET 7 2 5 7 22222222 55555555

YSTO ( e-mail: PAN CON LECHE )
Martes 11.05.2010 / 10:44

ysto ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 10:38

ysto ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 10:33

dick onerzote ( e-mail: )
Martes 11.05.2010 / 03:26
un zaludo para toda la adn de parte del dick adn 38 rifa y kontrola pcl kulos

ARVIZU ( e-mail: )
Lunes 10.05.2010 / 18:26

( e-mail: )
Lunes 10.05.2010 / 16:12
jarudo lokos lado bajo pitudos mmm de ke metete cabron!!

( e-mail: )
Lunes 10.05.2010 / 14:46

( e-mail: )
Lunes 10.05.2010 / 13:59

fato ( e-mail: )
Lunes 10.05.2010 / 13:44
yo tengo mucho probema yo quiero mucho a yuda

( e-mail: )
Lunes 10.05.2010 / 13:17
k pinshe panochudos de los swk bien saben k los k no valen V... son ustedes peendejos cuantas veces no los isimos de water tenian q irle a pedir chichi alos bajos pinshes mamadorees ijos de la verga

NOoKSs ( e-mail: nokcer_08 )
Lunes 10.05.2010 / 06:17
saludos gente k le gusta el graff y el rap hoy paso x juarez spero y l atoren shidote lokos ay les dejo mitax de paso 1 saludotb para los 111 ke le estube caiendo ai d rato los huacho lokos... NOoKSs ¡gomez lokos! MPSCREW. SHIDO

( e-mail: )
Domingo 09.05.2010 / 18:24
son una bola de ppenndejos jajaj y los doblados no balen veerrgapinchhes muertos de ambre soy de un barrio muy famoso poes losculos delos unidos 7 m6 info y otros barrios nos conosen muy bien ya saven qe barrio selos cocha putos

EL KIRoNeKER ( e-mail: )
Domingo 09.05.2010 / 18:12
barrio jarudote lokos el kiro!! de la lbp crew saludos para toda mi gente ay tamos cana y a la V... los entrados ustedes ya saben a kienes les digo BJL barrio de barrios

( e-mail: JARUDO )
Domingo 09.05.2010 / 12:26
hahahahahhahahahhahahhaa en swk aipura SHOLA ASKEROSA.iukkk KE ASKO! hahahahahahhahaha-nomamenn.weii AGARRENLAONDA!pendejoss.somoss loss ke kontrolamoss JUAREZ.pinnchi PENDEJOS. pinnchis doble.tanto roioke tirann &sonn UNAMIERDA.hahahahahah pinnchis MEKOS.

( e-mail: )
Domingo 09.05.2010 / 11:58
barranse ala V... pinshees jarudos la neta no valen V... aqui los vergas somos los doble a putos

( e-mail: )
Domingo 09.05.2010 / 11:25

( e-mail: )
Domingo 09.05.2010 / 09:35

( e-mail: JARUDO! )
Domingo 09.05.2010 / 09:11
hahahhahhahahhahhahhahahhah PORFAVOR! HAHAHAHHA lasmujeress noss PREFIEREN pendejo! hahahahahhahhahha.nomames.TERRROOSOS JAJAJAJAJA! KERISAENVD.´pinchiss pendejos.hahahahahaha.

( e-mail: )
Domingo 09.05.2010 / 04:11
msk swk aa osk sc am esos y muchos mas si son grandes no M... como barrios tierrosos que se sientan a la mera hora jajajaja el @cme

( e-mail: )
Domingo 09.05.2010 / 04:07
la neta si daria verguenza tirar el barrio jarudo ese pinche barrio que, que te pregunten las morras de donde del jarudo jajajaja no mames que pinche verguenza pinche barrio tierroso nadie lo conose cambien de nombre o mejor no tiren nimadre jajajaja

( e-mail: )
Sábado 08.05.2010 / 08:49
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

SUENOKER ( e-mail: SUENOkerone )
Sábado 08.05.2010 / 06:32

( e-mail: )
Sábado 08.05.2010 / 06:29

( e-mail: )
Sábado 08.05.2010 / 06:24
si no asemos nada preguntelen alos pks pbu14 joya 7 ajaja nomas preguntel kalas por juarez . jarudo lokos

doble aaaaaaa ( e-mail: )
Viernes 07.05.2010 / 16:08
jajajajjajaajaja doble a

( e-mail: )
Viernes 07.05.2010 / 16:01
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

( e-mail: )
Viernes 07.05.2010 / 15:57
doble a lokos putricios maman con sus pinshes barrioos de mierda

( e-mail: )
Viernes 07.05.2010 / 15:40

( e-mail: )
Viernes 07.05.2010 / 15:35

( e-mail: )
Viernes 07.05.2010 / 12:54
y aunq se acoplaran los bajos los solos i los estupidos de los swk nunka la armaron pendejos siempre pidiendo chichi jajaj amarrense un huevo culones cuantos no an caido de su barrio weies no mamen

( e-mail: )
Viernes 07.05.2010 / 12:49
barrete ala V... pinche bajo 21 de mierda apestan putos cuantas veces no los isismos de agua i ustedes encuetados nos pelann la V... ia se los emos demostrados dos k tres veces pendejos son una bola de culos jjjaaa aki estamos putos

( e-mail: )
Viernes 07.05.2010 / 10:58

bajo 21 ( e-mail: )
Viernes 07.05.2010 / 09:16
k nomas disen k los aztekas se le ba a kaer el canton jaja i no e bisto nads los 2aa aki los BAJO 21 se los cocha mierdas

( e-mail: )
Viernes 07.05.2010 / 09:08

nuZa 2ac ( e-mail: barreal )
Jueves 06.05.2010 / 20:36
esto va para toda la bola de culones delos barri0os que ni se ollen en cd juarez no mamen putos si ya saben que juarez ya no es de P... barrios pendej0ossi no la arman o k si ? que es eso juarez es de grupos criminales no es de M... ya aque el uniko barrio que la arman son los doble A si ya saben culones para Que se la jalan P... ya se la saben el doble *A* rifa i vive putos pa todos los alineados nos siguen pelando la vergotha asi nos gustha culoss son de water sigale cagando el palo i mas tumbaremos de su gente arTistotas asesinos cochando alos culosnes de aquii nos pelan la V... vdd aseptenlo 2ac l0ocos

( e-mail: oneQkonee's.Ds )
Jueves 06.05.2010 / 19:33
eiith ps aee ndoo n stha chengadera haha nmas pa mandarle un saludeiio a mes qmpas delaa BDR ee ora pss d ratoH..

B SIETE! ( e-mail: )
Jueves 06.05.2010 / 17:11
jaja devolada se ve q eso no lo puso el fioner jaja sta P... son jarudos neta ps si nosostros no andamos qon M... BARRIO SIETE LOQOS

doble a ( e-mail: )
Jueves 06.05.2010 / 13:27
y loos del 7 q de donde son e donde se juntan culones no mamen nadie los saka pinshes lomeros de seguro an de ser de san pancho pinshes lomeros de M... barranse ala V...

doble a ( e-mail: )
Jueves 06.05.2010 / 13:23
los del jarudo tienen q andar pidiendo chichi alos mugrosos de los solos xv maman putos les guzte o no les guzte nosotros no somos como todos ustedes nosotros somos una ranfla no un pinshe barrio pedorro

el doblee A ( e-mail: )
Jueves 06.05.2010 / 13:18
vaianse ala V... los del barrio 7 no mames donde queda ese pinshe barrio pedorro q nadie los conose jajaja i los del jarudo no se quedan atras puro pinshe tecato de M... no mamen weiees no lo pueden superar q somos mejores q ustedes vdd el doble a vive putos

r3d ( e-mail: )
Jueves 06.05.2010 / 09:15

( e-mail: JARUDO )
Jueves 06.05.2010 / 09:05
sii pinchi omosexsual.CAGADO-

( e-mail: el fioner B siete )
Miércoles 05.05.2010 / 20:57
ala V... los jarudo y mas los doblea aki la rifa los del barrio siete somos shingones los doblea son culotes shabalotas y llorones el drack es un panoshudo de M... me la pela el P... att fioner B7

r3d ( e-mail: )
Miércoles 05.05.2010 / 10:30

( e-mail: )
Miércoles 05.05.2010 / 05:36

( e-mail: )
Miércoles 05.05.2010 / 05:06
wacha carnalnotiress tu roio wei K'teeboi a vajar de tua abion-donde andas trepado wei.nosoi un lepe komo TU.asdeser weei.kuandote tenga enmis manos wei terekordare lo ke pussiste en este portal bato.para kke sete kite lo osikon.

DRACK ONER COCHA ( e-mail: )
Martes 04.05.2010 / 17:40

jarudo locos ( e-mail: )
Martes 04.05.2010 / 14:12
kuales pinchis doblea ni ke nada aki los unicos ke rifamos somos los pinchis jarudotes locotes clunoes apoco no y el ke diga ke no ke H... ue a toda su amdre puro pinchi jarudote locos y caiganle si keiren pinchis doble a ke a este pinchi barrio ustede sno entraran ni tomaran el control nunka putoss

( e-mail: )
Martes 04.05.2010 / 14:05
ala V... nos quieren desaparecer pero eso no se arma doblee a ai en todo juarez maman putos por uno q matan salen 4 ala V... el doblea rifa aqui i en sus pinshes barrios cagados

( e-mail: )
Martes 04.05.2010 / 14:01
del dooblee a puutoos

EL KIRoNeKER ( e-mail: )
Martes 04.05.2010 / 12:56
ke tranza gente aki nomas dejando marka putos el jarudo siempre controlara y rifara atte el kiro saludo pa todo el lado bajo..el kironeker de la lbp crew

jose ( e-mail: )
Martes 04.05.2010 / 12:16
ke royo pinchis nakos apoko se kren muy narkos dan risa bola de P... todos los P... kon su ropa chafa jaja kon su mexican eagle y su holister jaja bola de P... muertos de ambre

red ( e-mail: )
Martes 04.05.2010 / 05:15

( e-mail: )
Martes 04.05.2010 / 05:10
todos los de aki son unos sholos NAKOS askerosos. IUK.

( e-mail: )
Lunes 03.05.2010 / 12:14

( e-mail: )
Lunes 03.05.2010 / 11:35

jarudo lokos ( e-mail: )
Lunes 03.05.2010 / 08:00

sukyllone ( e-mail: ns )
Domingo 02.05.2010 / 21:46
jajaja swkaka pinxe barrio todo muertothe en haciendas no keda ni una palomita pork por k los ddesapartaron no ammen mui vergas yson unos kulones de primeraese deve ser un barrio pa la V... no mms no tiren tanta M... kulones jajajswkakkaka

( e-mail: )
Domingo 02.05.2010 / 13:56

( e-mail: )
Domingo 02.05.2010 / 10:26
no le ayo el pinshe caso de q los doblea a i loos d ee la linea esten peleando un pinshee teerritorio q no es de unoo de loos doos no mamen weeies pongansee a trabaajar mejoor

( e-mail: )
Domingo 02.05.2010 / 07:12
la neta antes si eran barrios los msk swk leones 13 19 velarde sc osk am info park y muchos mas pero ya ase acabo todo ,antes controlavan las pandillas en juarez todo buenos grafitis buenas lineas de todos pero ahora ya no todos esos pinches barrios tierrosos no valen V... se cren muy H... ones solo porque usan pistolitas de salva jajaja by @cme

EL KIRoNeKER ( e-mail: )
Sábado 01.05.2010 / 17:52
ke tranzaa!! barriio JARUDOTE LOKOS !! jarudo los cocha a todos los entrados.. el kironeker'' ee esperate tu keeee suenoker eso kee!! bn kagadote

drack ( e-mail: )
Sábado 01.05.2010 / 16:21

SUENOKER ( e-mail: )
Sábado 01.05.2010 / 12:59

( e-mail: )
Sábado 01.05.2010 / 08:52
l0s d0blad0s

( e-mail: )
Sábado 01.05.2010 / 08:20

el kyfesiillo0 msh ( e-mail: crower gr )
Viernes 30.04.2010 / 17:49
qye transa putos el kyfes juanto con el cr0ower se los coje a todos los barrioss msh rifan puros atte el kyfesillo0 y el crower

( e-mail: )
Viernes 30.04.2010 / 14:07
do0blea l0k0s ala V... esta muertote aqui

( e-mail: )
Viernes 30.04.2010 / 13:56
puro0 113 lo0ko0s aac

( e-mail: )
Viernes 30.04.2010 / 13:52
puro doble a l0k0s put0s

( e-mail: )
Viernes 30.04.2010 / 13:26

( e-mail: )
Viernes 30.04.2010 / 13:17
puro swk south side locos pocos pero locos el SUEÑOKERONE

( e-mail: )
Viernes 30.04.2010 / 12:51

( e-mail: )
Viernes 30.04.2010 / 12:45
do0s a c l0k0s

( e-mail: )
Viernes 30.04.2010 / 12:33
south sidee

( e-mail: )
Viernes 30.04.2010 / 12:28
doblee a muunni

( e-mail: )
Viernes 30.04.2010 / 12:24
rip tibu,iker

( e-mail: )
Viernes 30.04.2010 / 12:20
saludando alos doble a

( e-mail: )
Viernes 30.04.2010 / 09:02

el norteño ( e-mail: elnorteño, )
Viernes 30.04.2010 / 08:33
ya dejense de P... que el unico amo y señor de juarez es el chapo aunque les duela bola de culos tacuaros ya porque traen una pinche resortera se creen hombresd putos

clow ( e-mail: )
Viernes 30.04.2010 / 05:56
somos pocos pero locos aqui estmos y no nos vamos terrenos 13 estes donde estes aqui rifan el uno y el tres

RED ( e-mail: )
Jueves 29.04.2010 / 16:07

( e-mail: )
Jueves 29.04.2010 / 16:01
ala V... doble a vive putos

REDzazo ( e-mail: )
Jueves 29.04.2010 / 15:59

( e-mail: )
Jueves 29.04.2010 / 15:43
doble a lo0ko0s putos

( e-mail: )
Jueves 29.04.2010 / 14:24

( e-mail: BJL )
Jueves 29.04.2010 / 13:50

SUENOKER ( e-mail: SUENOkerone )
Jueves 29.04.2010 / 08:37

shiiriinass ( e-mail: )
Jueves 29.04.2010 / 08:31
aquii les va un mensajiito0 del shiriinas de lo0s SWK putiit0s t0da esa v0la de putiit0s q n0mas avlan vaiianse ala niickk put0s aquii se sientan c0n lo0s SWK PBO0 13 co0chaa puto0s del bariio0 delaa 0OBRERAA puto0s q avlan ii le piden chichii a mamii culo0ss

( e-mail: )
Jueves 29.04.2010 / 07:29

SUENOKER ( e-mail: SUENOkerone )
Jueves 29.04.2010 / 07:24

JL ( e-mail: )
Jueves 29.04.2010 / 06:44
ke roio pinchees chavalaas, no la esteen kagando aki el dover de la sur cana, ai tamoos pinchee vatos kuloos... la S los represeenta ai tamos klen, saludoOs a toda la razaa del gun, chidoote gentee

myzzy ( e-mail: )
Miércoles 28.04.2010 / 22:41
swk no valeen V... no se k levanthan si no tienen genthe kul0os jajajaj pinxes panochithas

2ac barreal ( e-mail: )
Miércoles 28.04.2010 / 22:38
valeen para pura V... t0od0oz n0o saben Qe es barrio pendej0os sto va pa l0os putos s0ol0os 15 son una vola DE kul0os no pueden tienen k andar pidiendo chichitaa par de kul0ones i tambn l0os baj0o 21 son una bola demariko0nes ya sela saben el 2ac siempre rifara par de kul0ones l0os aac lo0k0oss controlando a juarith0os no valen V... putos

oxo ( e-mail: )
Miércoles 28.04.2010 / 14:47
rip oxo mp oxo y jenni te extrano un H... o mi chikito rip oxo 10-junio-2009 nunka te boy a olvidar in memoria of daniel 27 de la manuel valdez

sstk ( e-mail: )
Miércoles 28.04.2010 / 14:40
sstk de la zaragoza sige rifando putos digan lo ke digan sstk surenos sstk surenos saludos al gordo de la stk

Miércoles 28.04.2010 / 12:57

( e-mail: )
Martes 27.04.2010 / 20:30

( e-mail: )
Martes 27.04.2010 / 20:20
valess berrga sueño me la pelass tu y tuss swk,sabess de echo tu perro barrio andaba mamando al JARUDO,tu no sabess ni madre weii tu ni sikiera estass en juarezz tu clikilla ya no existe,ya son puros P... drogadiktos,jeje el dissa te penetra y solito weii..JARUDOTE.LOKOTESS DE JUAREZZZ,EN LA CUESTA PA KE LE CAIGASS CULEERO TRABESSTY...

REGALADO ( e-mail: SUENOkerone )
Martes 27.04.2010 / 20:05

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 20:02

( e-mail: )
Martes 27.04.2010 / 18:42
H... en su madre todos los swk son puro tecato muertos de amble,el sueñoker me la pela POR SYEMPLE eres C... weyy el dissa del JARUDO.LOKOS SUR X3 TE PENETRA PUTO MOKOSSO CAGA PALO..TU NO ERESS SUREÑO MOKOSO CAGOON..ERES DE AGUAA CHAVALA JARUDO DE POR VIDA

Martes 27.04.2010 / 16:57

EL KIRoNeKER ( e-mail: )
Martes 27.04.2010 / 16:30
A la V... los swk,, puro Jarudote lokos los cocha culeros,, un saludo pa todo lado bajo!! el KIRONEKER pa lo k pidan putos

loko_el zorra_loko putos ( e-mail: )
Martes 27.04.2010 / 16:20
________doblea_________lopkos________ miren esto P... d los tal juarudos o d los linea todo lo q ponen es enbidia por q ustedes no púden kontrolar juarez ni la plaza miren hijos d su P... si no s quieren morrir mejor no pongan nada si miren si quieren konprobar q el doblea es chimgon ballan a rinkones de salbarkar don d estamos P... y tambien los putitos de los bajos 21 m la pelan nunka pudiron supuestamentre kon el turka,chino nunka pudieron y los solos tambien tiran micha miierda mieren P... los doblea akabaron kon su P... barrio nose agan P... nuka pudieron a los putitos d los cuates nunka m hicieron nada ni el P... del choche ni del sonrics y para los aztecas tambien tienen enbidia y mas los d la line__ son putos ]]]]]]] doblea lokos ]]]]]]]] el zorra]]]]]]

( e-mail: )
Martes 27.04.2010 / 12:48

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 11:34

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 11:21

drexter ( e-mail: )
Martes 27.04.2010 / 11:11
jaja ai tamos mi jent del jarudo lokos cana un saludillo para las klicas unidas y ai tamos mi disa jarudo lks drexoner stop lbpenetrandot

( e-mail: )
Martes 27.04.2010 / 10:39

( e-mail: )
Martes 27.04.2010 / 10:30
bete ala V... pinche mokoso no sabes ni lo ke dises P... suñoker vales M... sureño 13 de los angeles california en san diego P... rifamoss sureño vida homieess...sur x3 tu i tu pinche clica de M... me la pelan swk,son putos lavacarross.

SUENOKER ( e-mail: SUENO )
Martes 27.04.2010 / 07:45

( e-mail: los doblea rifan )
Martes 27.04.2010 / 07:06
un saludoo para todos mis secuestradores del jarudo saven bien qe los doblea somos los shingones aqui nomas trabaja pura jente H... ona artistasasesinos adentro y fuera de cereso somos la V... parada

sstk ( e-mail: )
Martes 27.04.2010 / 05:19
sstk surenos sigen rifando putos pinches maricones ustedes puro bla bla bla

bjlstop ( e-mail: )
Lunes 26.04.2010 / 20:45
jarudote lokos bjl de aki aya ono jente el stoop

REGALADO ( e-mail: SUENOkerone )
Lunes 26.04.2010 / 18:43

carlitos ( e-mail: SUENO )
Lunes 26.04.2010 / 18:39

( e-mail: )
Lunes 26.04.2010 / 17:38

( e-mail: )
Lunes 26.04.2010 / 14:50
puro jarudo lokos SUR X3...esos pendejoss ke se disen ser sureños ke enseñen el pinche tatuaje.PINCHES

( e-mail: )
Lunes 26.04.2010 / 11:38

jorge ( e-mail: )
Lunes 26.04.2010 / 05:26

sstk ( e-mail: )
Domingo 25.04.2010 / 10:12
vayanse ala V... ustedes sstk los cocha putos sstk rifa pendejos

kironeker ( e-mail: )
Domingo 25.04.2010 / 09:53

stooop ( e-mail: )
Domingo 25.04.2010 / 03:14
bjl1 desdeluego jarudo lokos el stop UNO1 pinches mamavichos ay con calidad JARUDO losdela uno jarudote aytamos jente

( e-mail: )
Sábado 24.04.2010 / 13:48

SKOr!!jarudo haciuendas! ( e-mail: )
Sábado 24.04.2010 / 09:31

caca juarez ( e-mail: )
Sábado 24.04.2010 / 08:34
juarez es un vale caca

( e-mail: )
Viernes 23.04.2010 / 15:54
negro de los sstk no vales V... culero

( e-mail: )
Viernes 23.04.2010 / 14:53
jajaja sstk sur sela rifa con todo juarez y todo zaragoza sstk los cocha putos culotes sstk surenotes x siempre

( e-mail: )
Viernes 23.04.2010 / 13:59

EL POKE ( e-mail: )
Viernes 23.04.2010 / 13:27
JAJAJA SI pinche kilo P... no sabe cochar jajaja arre mija yo si se, con migo si sentiras no como con ese P... precoz jajaja

( e-mail: )
Viernes 23.04.2010 / 09:22

( e-mail: )
Viernes 23.04.2010 / 07:47
pinche guerejo ensenate a cochar x ke no siento nada con tu vergiya pinche kilo no vales V... pinche mocoso P... medas asco para jose trinidad melendres alias kilo atte mirna saludos atu novia ale ke no te kiere jajajaja sufre perro

( e-mail: )
Viernes 23.04.2010 / 07:13
sstk surenos x siempre arifado y se gira rifando pinches ojetess sstk sur

( e-mail: )
Viernes 23.04.2010 / 07:10
sstk surenotes

kuate ( e-mail: )
Jueves 22.04.2010 / 18:21

( e-mail: )
Jueves 22.04.2010 / 16:02
doble a l0k0s

( e-mail: )
Jueves 22.04.2010 / 15:57
doble a aqui rifando

( e-mail: )
Jueves 22.04.2010 / 15:20
kual pinchi jarputos valen V... rifando y controlando sstk surenotes cochan

kIRO ( e-mail: )
Jueves 22.04.2010 / 12:11
JAJA Es todo mi clen esi se culea, ya estan todos panikeados, o alomejor no an conseguido dinero para poder ir a las compu a rentarlas jaja pinches lomeros jediondos el kiro los cocha y los dedea putos barrio jarudote y lado bajo crew

( e-mail: )
Jueves 22.04.2010 / 10:23

( e-mail: )
Jueves 22.04.2010 / 09:58
mp rifando y controlando rip oxo rip oxo jenni y oxo for ever oxo y jenni

juarez ( e-mail: )
Jueves 22.04.2010 / 09:54
para las cherrys de la m valdez jenni yobana lucia alejandra son las mas H... onas sstk

tuti ( e-mail: sstk** )
Jueves 22.04.2010 / 09:48
puro sstk surenotes rifan y controlan ak en zaragoa y en juaritoz

lalalala ( e-mail: )
Miércoles 21.04.2010 / 20:51
ya dejense de M... i mejor ponganse a resarpa k no les mochen la kabeza pendejos juarez no vale V... puro sikario kul0o cristo los ama

SINALOA ( e-mail: )
Miércoles 21.04.2010 / 20:46

kIRONEKER~` ( e-mail: )
Miércoles 21.04.2010 / 17:57
PINCHE chato C... ni puede correr el weii y el Kleens asta lo izo correr del pinche paniko si sitenias q ser lomero pinch C... cojo

kiro bjl ( e-mail: )
Miércoles 21.04.2010 / 13:27
a la V... todos se los cocha el jarudo el kiroo de la LBPcrew

RED ( e-mail: )
Martes 20.04.2010 / 07:29
KrOnIcKz wEedZ sMoKeRz CrEw KWSC el RED CLKAKOS 90

RED ( e-mail: )
Martes 20.04.2010 / 07:21

red ( e-mail: )
Martes 20.04.2010 / 07:15
Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo Te

( e-mail: )
Lunes 19.04.2010 / 21:16
pinshes swk a qe le tiran ia ni existen pinshe barrio ya ni pego no se para qe levantan esa marranda antes era otro pedo ahora son fantasmas ia murio la sw ala brava ia no valen para pura vergaaaaaaa

REGALADO ( e-mail: SUENO )
Lunes 19.04.2010 / 20:15

SUENOKER ( e-mail: SUENOkerone )
Lunes 19.04.2010 / 20:12

SUENOKER ( e-mail: SUENOkerone )
Lunes 19.04.2010 / 20:04

jArUdo L k S ( e-mail: LBPKrew. )
Lunes 19.04.2010 / 14:53

kironeker ( e-mail: )
Lunes 19.04.2010 / 13:27
soy el kiro del jarudo lokos P... tu kien H... ados te crees pinche vende donitas de azukar tenias k ser del pinche mini anapra, a tu mama la violo el pinche diablo cabron

( e-mail: )
Lunes 19.04.2010 / 07:52
no ma men eso Qee miReen mejor pongansen a estuuDiiar eso de g

PB7! ( e-mail: BARRIO SIETE! )
Lunes 19.04.2010 / 07:44
jajaja aver aver aver tu qien eres wei jaja nadie te qonoce! BARRIO SIETE TE QOSHA!

KIRONEKER'S ( e-mail: )
Domingo 18.04.2010 / 08:02

red ( e-mail: )
Viernes 16.04.2010 / 10:42

TATOOS 13 ( e-mail: SUTATOOS13 )
Miércoles 14.04.2010 / 09:36

( e-mail: LINEA! DE JUAREZ )
Lunes 12.04.2010 / 07:26

Lunes 12.04.2010 / 07:19

jarudo LOKOS.1 ( e-mail: theklen )
Lunes 12.04.2010 / 06:57
jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo SE LOS COCHA ATODOS KE DISE NOS ASEN DE AGUA JAJA .. LBPKrew..

pickos ( e-mail: )
Domingo 11.04.2010 / 13:34
pclokos los kocha adn aora dan nalgas a los 725 y el sney q ni la vuele a qui dejando marka el sckot y el nicklo pickos sckot los kocha adn kulos pcloooooooooooookooooooooooosssssssss el fasty el H... on los ace de aguas

HeLiO!PB7! ( e-mail: BARRIO SIETE! )
Domingo 11.04.2010 / 08:18

( e-mail: )
Domingo 11.04.2010 / 05:54
msk galeanota 4 ever and 4 life the clika number one of the world mex side kings 4 ever, by @cme msk

zNeeL ( e-mail: )
Sábado 10.04.2010 / 14:14
BaaDbooiiZooTaa DiieeZyNuueeVee tHee ZneeLooQuiiTooW

( e-mail: )
Sábado 10.04.2010 / 14:11

( e-mail: )
Sábado 10.04.2010 / 13:04
estaan BN cagados

( e-mail: )
Sábado 10.04.2010 / 12:32
acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acgacg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg

ACg! ( e-mail: )
Sábado 10.04.2010 / 12:08
keeee tranzaaa MIJASSS aki nomass deJANDO LAA MARKA YAA REGISTRADA SANTANITAA LOKOSSS PAA TODOSS ESOS SHAPETONESS ! AcGlokotesss! ya lebantados por todo juaritoz )

KLEN BJL .LBPKrew.- ( e-mail: )
Viernes 09.04.2010 / 14:43

ARES ( e-mail: )
Viernes 09.04.2010 / 10:02

ares ( e-mail: )
Viernes 09.04.2010 / 09:57

trane ( e-mail: )
Viernes 09.04.2010 / 06:30
adn lockotes se cocha a todos

( e-mail: BJL'UNOS. )
Jueves 08.04.2010 / 18:42

paLomo ( e-mail: PB7! )
Jueves 08.04.2010 / 14:00
jaja PENDEJOO! pinshe ignorante nii sabes qomo me llamo! deseguro tenias q ser del jarudo igual de meqote q todos los de aia jaja BARRIO SIETE QOSHA!

red ( e-mail: )
Jueves 08.04.2010 / 10:36

red ( e-mail: )
Jueves 08.04.2010 / 10:26

red ( e-mail: )
Jueves 08.04.2010 / 10:14

( e-mail: )
Jueves 08.04.2010 / 10:12
oye pinche palomo eso k wei cambiate el P... nombre wei no mames,ta bien cagado neta pinchi meko simberguensa jajajajajajajajajjajajjaj

( e-mail: JARUDO asta la muerte )
Jueves 08.04.2010 / 09:49

AZTEKAS ( e-mail: )
Miércoles 07.04.2010 / 19:09
puro JARUDOTE lokoss cana asi d simple asi ess la vergota en el bariio jarudo lokos y pelones 1 cochan pur jarudo saludos para el skor klen gun nox drex fiver kiro spek yesk wike stop diees homie mago doser file gost doky duda kuba drak disa y a todos los JARUDO DE LA CUESTA HACIENDAS OASIS Y TODOS

( e-mail: )
Miércoles 07.04.2010 / 18:57
nndaa mass caagandoohhLaa cmooh siiempree yaa nooh maamenn tantoohh piitooh see qkeedaaraann siinn saaLiibaa weeyyess

( e-mail: JARUDOTE. )
Martes 06.04.2010 / 18:06
hahahahahahhahhahhahhahahhah LANETA IJOS DEPEERA' nossmetimosss astaa dentrroo del pinncchi kucchitrill laa pinnchi CASA roñosaa. NO DIGAN kee no ijossddeputtaa hahahhaa-loss asemoss mierdaa i eramoss komo 10 pendejooosss. hahahahahhahhahhahahhah KOMO less kedoo el GRAF hahahahhahhahahhahhahhahhahhahhahahha ese pinnchi MOKOSO MEKO ES BN KULOOOOOOOO KULOOTTTEEE. NOSEE LO kissoo daarr de acholee mejorr see fuue konn los polisss HAHAHHAHHAHAHH POBRESS ESTUPIDOS.NETA. UNAA kosaaa mmass ROÑOOSSOS porkkee sonn taann BIEJAS i meteen demanndaaa hahhahhahhahhahahahhahhahhahhahhahhaha pinncchi MARIKONES. rpscreew'

barrio siete lokos ( e-mail: BARRIO SIETE! )
Martes 06.04.2010 / 17:26
q putos el otro dia nos qisieron hacer de agua ii valieron V... nomas para q vean q no entran tan vergas al barrio ii no esta soLo!! ii qomo les qedo el weii q desmadramOs el sabadO en los telefono?? jaja nomas para q se qaLen putitOs! ia aqaben de pagar sus qantones fiados pinshes quLones! jajajajajajajajajajajajajajajajajjajajajajjajajajajajajajajajajajajajajajjajajajajajajajajajajajajajajajajajajaja BARRIO SIETE eL HeLiO! eL paLomO eL wisO ii el drek!

( e-mail: )
Martes 06.04.2010 / 10:10

( e-mail: )
Martes 06.04.2010 / 05:07
se k no conocen a los k nombre pero son de su pinchi barrio,,,,pinchis mocosos cuando tope a uno de ustedes no c la ban acabar de rato gente nos vemos en la torcida

( e-mail: PGS 77 )
Martes 06.04.2010 / 05:04
saludotes pa mi gente loka del jarudo pal juanillo,el mata,tragedias y al mostriyo pal 7 al gato,pirata quino y al apy pura gente lokota k rifaba en el EXO JUAREZ

( e-mail: PGS 77 de los 90"s )
Martes 06.04.2010 / 04:59
pinchis mocosos del 7,sigen siendo lomeros como los longos de su barrio,ni sikiera saben kien iso esa virgen en donde c lucen tomando fotos. y los de jarudo k no saben ni kienes empezaron el barrio jajajapobres chavos igual de P... los 2 barrios x k estan entrados y desde cuando??????? pinchis tontotes no conocen nada de su barrio,pero si le salen x el jajajaaj

ALIEN ( e-mail: GFG@HGGF.NET )
Lunes 05.04.2010 / 18:29

NENE ( e-mail: )
Lunes 05.04.2010 / 12:53
si que maten a toda esta escoria infrahumanos y limpiar a juarez de tanta basura

roro ( e-mail: )
Lunes 05.04.2010 / 12:50
y aqui que pedo puro anormal cholos de M... no se por que no los quiebran a todos los vatos de la linea para que se acabe todo el pedo pero yaaaaa!!!!!!!!!!!!!!

junior ( e-mail: )
Lunes 05.04.2010 / 12:38
puro pinchi pelones 1 y pinchi jarudo loco cochan a tu jefa y rifan en tu pinchi barrio

HeLiO!pB7 ( e-mail: )
Lunes 05.04.2010 / 06:57

( e-mail: b j l )
Domingo 04.04.2010 / 14:39
jarudo locos

( e-mail: )
Sábado 03.04.2010 / 08:40

( e-mail: INFO3 )
Jueves 01.04.2010 / 17:22

( e-mail: )
Miércoles 31.03.2010 / 14:29
saken loz partys

( e-mail: )
Miércoles 31.03.2010 / 12:50

( e-mail: )
Martes 30.03.2010 / 13:57

( e-mail: RPS ESELCREEW' )
Martes 30.03.2010 / 05:08

( e-mail: )
Lunes 29.03.2010 / 23:46

( e-mail: )
Lunes 29.03.2010 / 23:43

cuate* ( e-mail: )
Lunes 29.03.2010 / 21:12
como tiras tu roio palomo ia tumbese sus roios de maliya kagado neta we nomas no estes cagando el palo en jarudo we ke despues ai andas iorando we ke tu ia no eres del 7 i la V... pinshi mokoso nena i simon we pongame lo kekiera por aki porke aste eso ere srete kulo en persona pinshi mokosillo P... losCANGRY TE KOSHAN jarudolks

( e-mail: )
Lunes 29.03.2010 / 21:01
jajajajajajajajaja ALBERTO como te quedaroon los vidrioos jajajajajajajajaj ATTE:Paco y Palomooo tu pesadiilla jaja

adn 38 ( e-mail: )
Lunes 29.03.2010 / 09:32
adn 38 nomamen culos no la pelan los 725 los vamos a desmadrar de uno por uno a todos y el rafa dise ke les va a cargar la V... por andar mamando P... los adn 38 se los cochan

sckot 725 ( e-mail: )
Lunes 29.03.2010 / 08:54
shingen a su madre el sckot los kosha ahora koshamos alos q dominan disq ustedes bola d kulos y al kulo del pelon q no la kaliente x q si no ban a baler berrrgaaaaa kulos 725crew los koshan

( e-mail: jarudoo locoos )
Lunes 29.03.2010 / 07:57
ii cuando entren a jarudo no nomas en la primera cuadra metanse asta el fondo na qe shhingadoos hahahaahhaha no son pendejoos saven bien qee no salen de ai adentroo del jarudooo putoos

( e-mail: jarudoos locoos )
Lunes 29.03.2010 / 07:52
si wee haha como tiran rollo neta si bien qee los sacaron wee nomas para qee washen qe alas 5 de la mañana se meten ii de todos modos de donde qieran les salen ii a cualqier ora no como su pinshe barrio fantasma qe no se aya a nadie aunqe sean las 6 de la tarde nomas para qe washen qe a todas horas ai jarudos en las calles

fernando ( e-mail: )
Lunes 29.03.2010 / 06:38
no k onda un mensaje para los tandos locos de san angel sur

( e-mail: BARRIO SIETE! )
Domingo 28.03.2010 / 17:00
jaja q roio qomo les qedaron los vidriOs jaroshillos?? jaja nos la pelan ii el yesk todo qulo no se qiso dar un tiro de a shoLe ni xq tiramos las piedras i andabamOs sta adentro de su pinshe barrio QAGADO, i el fredy tmb todo QULO no se qiso dar un tiro les digo son bn SHAVALAS ii es mas la habLadera q traen q lo q hacen jaja ii esto apenas empieza AMARRENCE!! BARRIO SIETOTE!

el papa de los pollitos ( e-mail: )
Domingo 28.03.2010 / 12:16
H... uen a su P... madre todos pinches cholos de M... se esconden detras de una pinche computadora jajajaja me dan risa eso no es tener huevos eso se llama ser culos jajaja pinches cholos P... muy vergas se cren pero ala mera hora se sientan putos att cartel de juarez nosotros si tenemos mas que huevos y lo emos demostrado a nivel mundial

( e-mail: )
Sábado 27.03.2010 / 10:12

reote one ( e-mail: )
Viernes 26.03.2010 / 20:05
saludos al war sure dido senso dae sifo y a todos los de la bb dd rr south side 13 de haciendas y alos msh del granjero su home el reote desde denber col ssl

( e-mail: JARUDOTE )
Viernes 26.03.2010 / 19:17

( e-mail: jarudote )
Viernes 26.03.2010 / 09:07
hahahahhahha io solo los agaoo korreerr PENDEJOS hahahahhah pobress mekoss NETA esperate esparate kee komo noss kedoo la ´plakaa hhahahahhaa lla pintaronn & AORA KOMO LES kedoo la MIAA hahahahhaahahaahahh PENDJOS.

DREAM AND GARY ( e-mail: )
Viernes 26.03.2010 / 05:40

( e-mail: B SIETE! )
Jueves 25.03.2010 / 16:37
x cierto qomo les qedO la plaqilla tashada?? jaja iluego anoshe los shavillos iorando i deciendo no tiro jarudo jaja mas SHAVALAS no pueden ser les digO. eL SIETE se los QOSHA!

( e-mail: B SIETE!! )
Jueves 25.03.2010 / 16:25
jaja se qren mui verrgas nomas xq asen un desmadrecillo pinshes jaroshos jaja pero buenO nomas amarrence xq va la de nosotros jaja B SIETE!

( e-mail: JARUDOTE )
Jueves 25.03.2010 / 14:46
nosotross somos los unikoss ke dominamos GENTE

adn 38 ( e-mail: cholito 38 )
Jueves 25.03.2010 / 06:45
un saludote a la jente del adn 38 del roma de parte del cholito 38 a y a los cvs 38 controlando y dominando

( e-mail: JARUDOTE )
Miércoles 24.03.2010 / 17:07
hahahah mee metooo a raaiiaarrr EN LA KARA DEL wooffee & no mee diccee NADAA hahahahahhahahhahhahahhahhahha PENDJOS

( e-mail: )
Miércoles 24.03.2010 / 15:02
qe transa oxer.. soe el rocka we , saqa una pinta wey................................................ ................................................. apoco los pinches lomeros piojosos lomeros tienen computadora jjaja jarudo selos cocha putos jaja elrockaone!bjL!!

( e-mail: jarudoo locoos )
Miércoles 24.03.2010 / 13:10
qee siete lomeros pra qe washen qe no nomas ablamos ia les isimos el desmadre hahahahha aii pobresitos pero como no somos comformistas vamos aser mas para qe no anden de llorones como ahorita trallendo soldados ii poniendo demandas neta tss qee culos pinshes shavalottototas ia vieron qienes son los buenos i qee como qedo el siete bonito noo ? hahahahaha ii sus camionetas tambien hahahhaha

BJL .. LB ( e-mail: )
Miércoles 24.03.2010 / 13:07

oxer96 ( e-mail: )
Miércoles 24.03.2010 / 10:47
k tranza raza de juaritos soy el oxer de el paso tx un saludo a todos los k no an dejado morir al graff.

B.J.L ( e-mail: )
Miércoles 24.03.2010 / 08:59

( e-mail: )
Miércoles 24.03.2010 / 08:51
mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssshhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllll msh locos

( e-mail: )
Martes 23.03.2010 / 17:39
oigaaan laaa vdddd esquee soi bisexuaal i andoo buscandoo parejaaa i pues me dijieron que me comunicara con el tal fioner que tmb es BI solo kiero conosertee papii me diceeen MIQS para cuando kieras solo contestamee este msj MIQS selas mama pero mas al fioner que es BISEXUAL meeamoor ¢¾

( e-mail: )
Martes 23.03.2010 / 17:35

( e-mail: JARUDOTE! )
Martes 23.03.2010 / 17:05
hahahahah ahueebboo PUTOS loss segiraa cochannddoo SIEMPREE SIEMMPREE hahahaha.el fioner lloro el fioner lloro JAJAJAJA unsaludo AL SPEEK. RPSSCREWW.LOKA!

( e-mail: hahhahahah pinnchi marikonnn & aparttee LLORON' )
Martes 23.03.2010 / 16:59
el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr

( e-mail: )
Martes 23.03.2010 / 16:57
hhahaha al fioneeer ia ponganlee una mascaraa no valeee V... su facee neethaaaa i pobrees lomerooos cada diaa van valiendoo vergaaa ya ni el pinchii royoo que tiraaan pinchiis costrudos mierdas i veean elñ cal tv tss pobrees JARUDOOOOOOOOOOOOOOTEEEEE LOS COCHAAAA I LOS SEGUIRAAAA COCHANDOOO DONEROS DE MIERDAAAAAAA un saludooo al slatuno aithamooos CARNAL BJL'RPSPEECK COCHAAAAAA ! ! ! !

( e-mail: JARUDOTE )
Martes 23.03.2010 / 16:29
hahahaha H... atuu madree komo? JAROCHOS hahahahahahahahahahahahahhahahha nomamesss MEKO bbeetee en un espejooo ASKEROSO hahahahaah pinnchi MEKO estupiddoo'sonn unaa bolaa DE KULOS tooddoss es la VD nomamess ABER el klenn se metioo astaa suu barrio i KEE nadiee se kisso DAR el tiroo JAJAJAJAJAJAJAJ KULOSS KULOS KULOS hahahahahah BN sabenn PENDJOS

( e-mail: )
Martes 23.03.2010 / 16:12

( e-mail: BARRIOSIETE! )
Martes 23.03.2010 / 16:07
aa pero como tiran royo pinshes jaroshos de mierda!! ustedes son los q eran qomo 25 i nosotros qomo 10 ii asi no la pelaron!BARRIO SIETE LOQOS!

( e-mail: )
Martes 23.03.2010 / 14:27

( e-mail: JARUOTE )
Martes 23.03.2010 / 14:21

aac ( e-mail: )
Martes 23.03.2010 / 13:44
artist6as rifamos panochitas no balen bergas kaiganle pa ber kuantos qbramos 1 saludo al jarudo q lla estamos akople kon el pandooooo ok kuidense l.s.e.a.d.e.r.guter.............

( e-mail: )
Martes 23.03.2010 / 13:34
aquii estamoos presentes pinches lomeroos y arre putos io ia no andoo en riñas peroo quiero agarrarme a putos mi barrio con su barrio a putasos para ver quien es mas H... on q quien putas pero se culean jajaja se metieroon nomaas dos weies y no se quisiseron dar un tiro pinches culones de M... BjL rps LOS NUMBER WAANNNNN!!!!!! aunq les duela MADAFAKAS

JARUDO LOKOS ( e-mail: )
Martes 23.03.2010 / 09:30

( e-mail: uoneqkoners. )
Martes 23.03.2010 / 06:24
O N E Q K O N E E ' S . .

( e-mail: jarudoo locoos )
Lunes 22.03.2010 / 18:53
qee mi fioner otra sicatris en tu cara de los del jarudo hahahahahahaa ai pobres sieterilloos es mas no se ni para qee tiran tanta M... si saven bieen sigan cagando la V... tambien para cuetiarles otravez sus casas

( e-mail: RPSCREEW' )
Lunes 22.03.2010 / 17:01
hahahahahaahahahahahahahhaha sonn unaa MIERDA lomerosss noss tieenneenn PANIKO vdd pendejooss.HAHAHAAHAHAHAH. asii noss gusstaann pinnchiss KULONES komoo OY pura bola de kulosss i ROÑOSOS ke nomass ASEN bola putoss HAHAHAHA nommmass eramosss 10 putooss ustedes ERAN komo 25 PINNCHI KULONES HAHAHAHAHAHAHAHAHHAHAHAHAHAHAHHAHAHAHHA SON UNAA MIERDAA

( e-mail: 656 el jarudo )
Lunes 22.03.2010 / 13:11
JARUDOTE LOKOTES!!!!!!!!MOST DANGEROUS GANG!! in ciudad juarez chihuahua

JARUDO. ( e-mail: kierennsegirrnuestrospasoss' )
Lunes 22.03.2010 / 08:20

info.EL JARUDO ( e-mail: JARUDO DS )
Lunes 22.03.2010 / 06:44
aky el jarudo reportandose desde westcoust,arre people tras de los askerosos lomeriyos ni un P... terroso puede ser del jarudo,tirenle los dientes cuando les digan k kieren ser del jarudo no c apiaden de los vende donas!!jajajaja

eeL yeesK de los cangry's crew ( e-mail: yesk jarudo locos )
Domingo 21.03.2010 / 21:17
un saludo para mis compas los rps lbp aii stamos atte el mishel del jarudo arre sieterilloos me shupan las bolas ii siempre me las an shupado culeroos aii sta lo qee los avia prometido hahhahahahaha

( e-mail: west side califas!!! )
Domingo 21.03.2010 / 14:03
barrio jarudo lokos asi c yama mi barrio y a donde kiera k bamos siempre le saltamos,pinchis maricones jarudo es mas H... on,si kieren entrarle lo pueden intentar pero pinchis vatos yo les voy a ensenar como m la van a memory rest in peace,mi karnalito"el toto"mi homie"el gordo" we love you homitos,we miss you

( e-mail: dark side jarudote!! )
Domingo 21.03.2010 / 13:50
k royo kien es ese hijo de la V... k dice k los jarudo de antes eran H... ones y k los de aora son puros k lado esta P... si es del barrio salgale yagales un paro guey no este tirando tanta M... C... no deje morir alos chavos,yo soy el k dijo lo de la vieja escuela culero,soy longo y eso aprendi nunca dejar morir alos del barrio y siempre le sali x todos!!!

( e-mail: EL PAPPI... )
Domingo 21.03.2010 / 07:26
pongan un mail de verdad pa k m inviten a pistear morritas de praderas

( e-mail: )
Domingo 14.03.2010 / 12:52

( e-mail: )
Domingo 14.03.2010 / 11:49 Lazs morrrithaz de praderaz

( e-mail: )
Domingo 14.03.2010 / 11:46
Qe rooioo pzs aKiii Lezs dejamozxs un Peqeeño mensajeee pzs shiidfozs suzs comentariozs puroo maton aki!! pz mejor toDozs saQen Lozs pariizs aver azsii kmo ladran piistean Lazs morriThazs de praderazs

SLAAT ( e-mail: )
Domingo 14.03.2010 / 09:56

KLEN BJL LBP CREW ( e-mail: )
Sábado 13.03.2010 / 03:23

( e-mail: )
Viernes 12.03.2010 / 18:14
aber aber el palomo q we no nos daba servesa a mi y al yesk para q no le pegaramoos pinche chavo de M... y hablas de mamarprimero deja de mamarnos ami y al yesk y ya hablas pinche bastardo o quieres otros pinches plomasoos en tu house jajajajajajajajajaja barrio jarudo el SNAFONE TE COCHA PENDEJO

el lier loco ( e-mail: )
Viernes 12.03.2010 / 07:29
cartelon 23 pinches vatos caga sangre valen V... ychupan huevos nadie los conoce por culnes el lier los cocha culotes

el reote one ( e-mail: )
Viernes 12.03.2010 / 06:58
un saludo para los msh del granjero y los surenotes 13 del bdr de haciendas pal warsito el sure el bambu dido senso de su compits el reote pts

( e-mail: )
Viernes 12.03.2010 / 05:34

LBP CREW ..BJL ( e-mail: )
Viernes 12.03.2010 / 05:04
HAHA NO MAMES palomo WEE AMI ME BALE BERGA SY TE LAS COCHAS.. SON biejas we aora no me salgas ke yo no ando con esos rollos .. we yy AMI ME BALE BERGA SE DONDE VIVO WE.. como tu casa parese ..tapias .. bueno son ay se akoplaron ajajajajjaaj.. UN JARUDO TE COCHO ATU HERMANA YY VIVE AY EN TU PINCHI KASA.. JAJAJA KE MAS CHINGADOS KIERES JAJA YY cual oskar mamamos yy el nos mama ke rollo mis jarudo ASY DE SIEMPLE NOS DIESEN .. aber sy cierto .. weee ke muy berguitas B A R R I O ..JARUDO ... L O K O S

( e-mail: )
Jueves 11.03.2010 / 15:02

( e-mail: JARUDOTE )
Jueves 11.03.2010 / 14:27
hahahahahahahha nosotrooss no MAMAMOSS a nadiee BASTARDO hahaha encammvio usteddes sii se agarraan de los HUEBOS de los unidos HAHAH pero kon elloos o sinn elloos sonn UNA mierddaaa PENDJOSSS.hahahahaha.ii kochensee alass rukkass aki EN jarudoo NADIE las pelo PERO NADIE weiii i puues no abiaaa de otraa KE irseee KON LOS piojossoosss.HAHAHAHAH nosotrooss tampokoo andamooss kon mamadass palomo BN sabbes BASTARDOO.

eL palOmO! ( e-mail: )
Jueves 11.03.2010 / 12:33
q putOs soi el palomO pasesen de vergas para matarlOs ala V... io no ando qon mamadas, me qoshO a sus viejas todos los dias ia se dnd viven todos para q se amarren! aii me seguiran viendo en su barriO!pendejos en el cherokee o en laa expediciOn jaja pendejossssssss. ii sigan mamandO al osqar!! jaja pendejOs!

( e-mail: )
Jueves 11.03.2010 / 08:19
DeeL KAMPANARIO putthOzz !!! ssomoss laa veerGaa !!

( e-mail: )
Jueves 11.03.2010 / 08:17

( e-mail: JARUDOTE. )
Jueves 11.03.2010 / 06:15
kkee kiereen los del 7 aasiendoo esas pendejadass nomammen no seaann pendejosss weiesss SIMPLEMENTE nossottros somosss loss ke kontrolamoss IJOS DE PUTA i bieenn sabben unaaa PREGUNTA porrkk asenn esasss pendejass PIOJOSOS hahaha de dessir no no la generasionn de oyy no bale berghaa JAJAJAJAJAJAJA bnn sabben kee rifamos puutoosss. hahahahahahahahahahhahahahaha

LA LINEA ( e-mail: )
Jueves 11.03.2010 / 03:52

( e-mail: )
Miércoles 10.03.2010 / 16:37
barrio jarudo lokos es H... on pero los de antes esta generacion son pura bola de culos ojala que mi jarudo vuelva aser como el de antes H... on no M... con puros pinches niños culos pero culos que me cala admitir puero nomas ven bronca y se meten a su casa con su mami ya vamos a demostrar el pinche color del barrio contra esos pinches vende donas de M... arre o que gente aver quen me contesta quien se agarra los wevos de los pinches chavos de M... del barrio a aser el desmadre con los lomeros

( e-mail: )
Miércoles 10.03.2010 / 16:32
ase mucho que no me metia y siguen mi gente del jarudo diciendo P... ya gente que no les da verguenza el ablador del klen no que ya iva a balir V... no as echo ni madre wey on ta el wey que arre a agarrar la vieja escuela les dijo mis jarudo amarrense un pinche huevo pero amarrenselos no puro bla bla ya no digan P... mis jarudo mejor actuen que no lo creo nunca ban a actuar pinches chavitos que traen haora no sirven para ni madre

( e-mail: )
Miércoles 10.03.2010 / 14:04

( e-mail: )
Miércoles 10.03.2010 / 14:00
bjarudolockos!!!los piojosos del siete son culos jarudo selos cocha putitas...

Miércoles 10.03.2010 / 08:28
QUE ROYO BUSCO AMIGOS CALIENTES con minusculas sexyyyy 37 besitos

( e-mail: )
Martes 09.03.2010 / 13:52

MR.DRECK*¢¾ ( e-mail: BYG TRISTE 13 )
Martes 09.03.2010 / 07:17

¢¾AZTECAS .V*B*T**13¢¾ ( e-mail: BYG TRISTE13 )
Martes 09.03.2010 / 07:13
p style="visibility:visible"object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" height="475" width="600" style="width:600pxheight:475px" param name="allowScriptAccess" value="never" / param name="allowNetworking" value="internal" / param name="movie" value="" / param name="wmode" value="transparent" / param name="quality" value="high" / param name="scale" value="noscale" / param name="salign" value="l" / param name="flashvars" value="cy=ms&il=1&channel=2449958197320723427&" / embed type="application/x-shockwave-flash" allowScriptAccess="never" allowNetworking="internal" src="" height="475" width="600" style="width:600pxheight:475px" wmode="transparent" quality="high" scale="noscale" salign="l" flashvars="cy=ms&il=1&channel=2449958197320723427&" / /objectp style="white-space:nowra

V*B*T*13 ( e-mail: BYG TRISTE13 )
Martes 09.03.2010 / 07:09

♫¢Ü¢¾MR*DJ*DRECK¢¾♫¢Ü ( e-mail: )
Martes 09.03.2010 / 07:05
ke rooyo atodas las putas de los doblados AA los bamos a esterminar AZTECOTAS putos de la col. INDEPENDENCIA#2 V*B*T*13 MR .DRECK *COCHON *JAJAJAJAJJAJAJ

( e-mail: snaaf UNO no hay mas )
Lunes 08.03.2010 / 17:21

( e-mail: )
Lunes 08.03.2010 / 17:15
aber aber los de el siiete q quieren we nos disen chabalas para empesar q nos desia el chato no io ia no tiro barrio es mas me quiero aser jarudo no me agan nada snaf tira paro pinchis chabalas y el fioner q andba aqui de biker y tmbn queria ser jarudo jajaja les digo q el jarudo es su padre jaja y loego se meten en ranfla pero nomas por las orillas pinches BASTARDOS de mierdas ia saben q el JARUDO esnumero uno en juarez PUTOS ok ia saben q aqui la rps y un saludo para el yesKARMELO arre ai tamos BjL rps CREW su dolor de cabesa pinches doneros de M... jajaja JARUDOTESLOKOTES RPSCREW

( e-mail: )
Domingo 07.03.2010 / 14:03
culos todos los pcl el sney ya saben donde vivo putos estoy puestoteee el SNEY de la ADN LOKOS son culos de amadre

SNEY ( e-mail: )
Domingo 07.03.2010 / 13:59
saludoos a toda la ADN q todabia se sigen le bantando en el muro y entodas partes el sney rip omek des canse en pas

FOWER ONE ( e-mail: )
Domingo 07.03.2010 / 06:49

( e-mail: )
Domingo 07.03.2010 / 06:24

cholito adn 38 ( e-mail: )
Domingo 07.03.2010 / 04:00
adn 38 y cvs 38 controlando el roma

sckot ( e-mail: )
Sábado 06.03.2010 / 12:55
saludos para los pclcrew al sprock,lemonsk,weat, al niclo,ysto,grate,snopy,signo,snocker,picos,fasty,smock,gasper,cone,fomek,eri,bleck,neo,pelon,more,blay,bart,crone,la miriam y la koral,cron y los q se me olvidaron y la kornyoner puro pclcrew para los kulos de los kanikas el sckot delos de la pclokos del roma

sckot ( e-mail: )
Sábado 06.03.2010 / 12:35
saludo desde delicias para los pclocos kocha del roma y a toda la jente de la divi y del grangero del chuko sigan graffityando komo siempre nosotros si graffityamos x q lo traemos en la sangre no x lebantar stilos del sckot pclcrew kontrol juarez y chihuahua para q no la kaguen los pinshes mokosos del roma 725crew ay los huacho karnales para dentro d unos meses ya se saben el royo para los pclcrewersota y para los 727 kontrolen toda la cuesta del sckot de los 725 chida bye

( e-mail: )
Sábado 06.03.2010 / 08:27
hola, la verdad no entiendo x k la neseda de echarse unos a otros x k diosito no les yama ni los reconose x sus apodos de gangas apeidos diosito nos quiere a todos x k mejor no mandar un saludo a sus seres queridos k no ven como a mi me encantaria k mis abuelitos supieran cuanto los amo pero el internet no yega asta mi pueblito pero bueno k diosito los bendiga y los cuide a todos

( e-mail: JARUDOTE- )
Sábado 06.03.2010 / 07:04
BAAARRRIOOjaruddddootte(8) LOKOS puutoosss.

YA SABEN putas! ( e-mail: )
Viernes 05.03.2010 / 10:27

( e-mail: )
Viernes 05.03.2010 / 09:37

GARY ONE! ( e-mail: )
Viernes 05.03.2010 / 09:13

( e-mail: )
Viernes 05.03.2010 / 09:05
miren hijos de la V... nadie los pela pobres P... son kulos salgale uno por uno muy vergas todos juntos aber uno por uno aber sie sierto pinchis chabalas uno solocorre y despues se la gasta de ke le sale mucho cuando andan todos bola de KULOS BARRIO SIETE!

( e-mail: elslaat' JARUDOTE. )
Viernes 05.03.2010 / 06:12
ttuu no le salesss ELIO ala vravvaa wei erss KULO. ASSI kee no tires ttu roio weii mme meto a raiarles en frente de suus caras wei le sale mas la rukaa gedionnda de la eskinaa hahah PENDEJOS.

cholito adn 38 ( e-mail: )
Viernes 05.03.2010 / 03:09
un saludo al adn 38 del roma y a los cvs 38 y a la V... los pcl

HeLiO!pB7! ( e-mail: )
Jueves 04.03.2010 / 15:13
aver sii muii vergas dii qien eres weii! PB7!

frank ( e-mail: )
Jueves 04.03.2010 / 13:51
ke pedo

sckot ( e-mail: )
Jueves 04.03.2010 / 13:03
kulo tu marika pos si bien saben q la calidad esta d nuestro lado ni le salen ni saben graffitear primero aprendan de latas y de tapas y luego rrayan rrayan como d kinder los 725crew rifan para los konikas d M... asta una rola ya les dedike y cuando quieran bengan para q huachen la kalidad del sckotonersotototottestar soludos al ysto al kondor al grate al nicklo el sprock el lemonsk el weat y a todos los pclocos de la divi y los 725 del grangero pcl los kocha pinshis kanikas kulos.

ARVIZU ( e-mail: )
Jueves 04.03.2010 / 11:25
ARRIVA LA PRM MEXICLES.esos putos jotos d los azcacas no traen nada.miran un borracho y c mean d miedo.aqui rifa puro PRM

Jueves 04.03.2010 / 08:29

( e-mail: losss MAMO. )
Jueves 04.03.2010 / 05:59

( e-mail: )
Miércoles 03.03.2010 / 11:35

el ckEr y el soE... ak47 ( e-mail: )
Miércoles 03.03.2010 / 05:42
saludos alos compas.. V... alos entrados.. !!

el ckEr ( e-mail: )
Miércoles 03.03.2010 / 05:38
ak47 ak47 ak47 ak47 ak47 ak47 ak47

cholito adn 38 ( e-mail: )
Martes 02.03.2010 / 07:59
un saludo de su gente para su gente del cholito del adn 38........cvs 38 controlando el roma

( e-mail: JUAREZ )
Lunes 01.03.2010 / 13:31
aarree arrreeeee JUARITOSSS kontrolanndddoo piinncchiisss BASTARDOSSS

LA LINEA ( e-mail: CD JUAREZ )
Lunes 01.03.2010 / 13:14

Lunes 01.03.2010 / 13:11

cholito adn 38 ( e-mail: )
Lunes 01.03.2010 / 04:40
el cholito del adn 38 se los cocha el adn 38 controlando p....pcl....culotes

ADN 38 ( e-mail: )
Lunes 01.03.2010 / 04:37
culo el sckot

skoR! ONE ( e-mail: )
Lunes 01.03.2010 / 02:45

CHOLITO adn 38 ( e-mail: )
Domingo 28.02.2010 / 10:28

CHOLITO adn 38 ( e-mail: )
Domingo 28.02.2010 / 10:25

sckot ( e-mail: )
Sábado 27.02.2010 / 18:56
mira P... no le tiembio kon el burro llego asta agachado pues lo ice de aguas una vez no se quiso bailar. pero no memes eras tu y 2 vatos y yo te cay solo y no kisiste tus compas tan culotototes le siguieron caminando hasta el taweck solo los baila culotes 725crew saludos a los pcl desde parral de rrato les caigo pinshes kanikas culos para my siempre ban a ser kanikas bola de jotos PCLOCOS CREW LOS KOSHA STILSCKOT DE LA 725CREWWWWWWWERSOTOTESTARKINSOTER

skoR!ONe BjLcK!hPl! ( e-mail: )
Sábado 27.02.2010 / 12:36

( e-mail: JARUDOTE. )
Viernes 26.02.2010 / 14:59
hahahaha IJO de tuu puuttaa madreee komooo llorabbas weii JAJA kuannddoo te atropellamoss weii hahahahaha pinncchi INVESIL ijo de la vergha tee voi a serraar el osiiko qq tiieennes weiii pinncchii RENGOO IJO DE PUTA.iooo mme mettooo a raiaarless en su puuttaa CARA pendeejoo i ME CAII ke le sale mmas la rukkaa roñosaa de la esskinnaa WEII hahahahhaha pincchii JODIDOSS idioottas.

axerone ( e-mail: )
Viernes 26.02.2010 / 14:35
jajaj y segun ustede los del siete ya no somos nadie no mamen todos los dias les entramos a su barrio y ni cuenta se dan P... preguntale al pinchi ivalido del pancho jajaj en el siete somos un H... o nomas ke ya nadie les hace caso mejor los tiramos al leon xk nomas la hacen de pedo y salen corriendo mejor nos evitamos gastar energias neta bien saben ke el barrio siete 727 los kocha pinchis babys ate el axerone y no mame no estoi cojo P... 727 727 727 727 los kocha jajaja ya mejor no la cagen xk les vamos a venir matando otro pinci mokoso weyes eske la neta ya nos dan lastima P... bie ( e-mail: )
Viernes 26.02.2010 / 14:31
jajaja pinchis jarudos neta asta dan risa son puros pinchis babys y dicen ke segun ellos entran al barrio jajaj no mamen nomas entran en la primer calle P... donde ni hay nadie weyes y eso de ke enfierrando cueteando atropellando no mamen ni ustedes se la cren jajaja

HeLiO!pB7! ( e-mail: )
Viernes 26.02.2010 / 12:05
jajaja BARRIO SIETE!! aunque les qaLe putOs!

( e-mail: JARUDOTE )
Viernes 26.02.2010 / 05:42
hahahahahahahahahahahahahahaha KOMO ME DASS RISA PINCHI NIÑA PENDJa

TU MADRE ( e-mail: )
Viernes 26.02.2010 / 03:53

HeLiO!pB7! ( e-mail: )
Viernes 26.02.2010 / 03:46
jajaja sii muii vergas dii qien eres ii arre quLo!! si bn saben todos q me la peLan!! BARRIO SIETE LOQOTES!!

( e-mail: JARUDOTE )
Viernes 26.02.2010 / 02:09
pinchi LEPE no ersssNADA weii ers unaa caca pinncchi VOZ deee niña toddooss TE SAKAAN por lo abladorrr ke ersss weii por otraa KOSA NAAA.-haha penddeJO.°

HeLiO!pB7! ( e-mail: )
Jueves 25.02.2010 / 14:26
jajaja simOn weii pero me la pelas BARRIO SIETE!

cholito adn 38 ( e-mail: )
Jueves 25.02.2010 / 13:04

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 13:01

SCKOT ( e-mail: )
Jueves 25.02.2010 / 11:45

Jueves 25.02.2010 / 09:40

skerone ( e-mail: )
Jueves 25.02.2010 / 09:36
qe tranza aqi les dejo mi firma soi el sker de los SGCK FUCK SIDE 11 DE LA SKOBEDO.

( e-mail: JARUDOTE! )
Jueves 25.02.2010 / 07:35
ttukkeeee? PINCCHI voozzzz dee pittooo metaaseeee a BAÑAR ijooo de la verghaaaa. HAHAHA

HeLiO!pB7! ( e-mail: BARRIO SIETE! )
Jueves 25.02.2010 / 04:38

( e-mail: B.J.L. )
Jueves 25.02.2010 / 03:37
PURO JARUDOTE LOKOS controlando la cuesta y k putos...atoda madre o un desmadre.salganke culos .....

( e-mail: JARUDO )
Jueves 25.02.2010 / 03:34

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 03:18
pan con mecos ke risa son culos los pan con leche no valen verga

cholito adn 38 ( e-mail: )
Jueves 25.02.2010 / 03:14
simon simon tengo 10 años pero le salgo mas ke ustedes y si me van a maranear pues maranenme para ver como les va y lo ke esta sonando aorita son el adn 38 los pcl ya pasaron ya no valen V... el cholito del adn 38 r... putos

( e-mail: pan y mekos )
Jueves 25.02.2010 / 03:13
pinchis mokosos P... k es eso de pan con mecos o k . ala V... putos cambien de nombre no sean P... dan risa mejor no pongan nada pinchis pan y vino o rei un putal cuando oi su nombre cagodo.c pasan d vergas neta

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 03:09
y por ke no le dijiste al burro cuando fuimos a su barriesillo si ay estaba tu barrio por ke ninguno le salto por culos nomas por le les tachamos su pinche muralsillo fuimos todos los adn 38 para ke sepas,y son bien culos por ke me agaran solo eee por ke cuando voy con mi gente no pendejos, adn 38 se los cocha

( e-mail: B.JARUDOTE.LKS )
Jueves 25.02.2010 / 03:09
ora chido PELONES 1 aver cuando les caemos paser un desmadre chidote..JARUDO LOKOS

( e-mail: pelonsotees uno )
Miércoles 24.02.2010 / 15:32
los pelones uno un saludo alos jarudo ya se la saven los ke rifan bp1 y bjl

sckot ( e-mail: )
Miércoles 24.02.2010 / 15:27
mira pentedejo no es barrio y los pan con leche estamos mas lebatados q ustedes yo doy clases de graff para q no rallen tan C... rallo mejor kon los pies y ustedes q no se acuedan de su barriesillo kk kanikas q es eso si eres un mocoso de 10 años qieres bailar al sprock y ni la cuajas valen pura vergota y no entiedes q ya le cambien x eso estan como estan

ADN 38 ( e-mail: )
Miércoles 24.02.2010 / 04:10

ADN 38 ( e-mail: )
Miércoles 24.02.2010 / 04:05

( e-mail: dsd )
Miércoles 24.02.2010 / 02:13
puro Barrio Jarudo Lokos

sckot ( e-mail: )
Miércoles 24.02.2010 / 02:10
no mamen ya cambienle pcl culos ya dan risa adn kosha no mamen kuleros primero aprendan a graffitiar rayan pala bergaaaaa y pongan apodo no sean kulotes. un saludo al snoopy,fasty,sprock,weat,,nicklo,isto,tawek,sonik neo,fomek y los q me faltan pcleche crew.desde cuauhtemoc

( e-mail: ONEQKONE''S )
Martes 23.02.2010 / 16:25

( e-mail: JARUDOTE- )
Martes 23.02.2010 / 13:40
chinngggeee asuu MADREE USTEDD WEI

ADN 38 ( e-mail: )
Martes 23.02.2010 / 12:50

( e-mail: JARUDOTE- )
Martes 23.02.2010 / 07:14
hahahahah ssii no puueddeeenn KON nosotroosss pinnchi VOZ de niññaa komo konn otrss weiies JAJAJAJA! pinchisss MEKOS!

( e-mail: HeLiO!pb7! )
Lunes 22.02.2010 / 22:49
soy el HeLiO y el fioner del barrio siete y me La peLan Los de La Linea !! hahahaha si muchos webos caiganLe al carteL del barrio siete !!

ADN 38 ( e-mail: )
Lunes 22.02.2010 / 11:51

( e-mail: )
Lunes 22.02.2010 / 06:50
altiro con las M... k ponen pinchis chavillos,novaya ser ke se los carge la tienen huevos metanse a lo grande a defender su a ver un reclutamiento pa los k se cren cabrones a demostrarlo como escuadrones

el doser del adn ( e-mail: )
Lunes 22.02.2010 / 04:54
un saludote para mis carnales del adn y el burro C... ke se llevo mi camara a mexico el hijo de perra el adn 38 cocha AHORA DOMINAMOS NOSOTROS 38

hbo ( e-mail: )
Lunes 22.02.2010 / 04:01
pinches jarudos no la pelan weies hbo los cochan putosylos ak

hbok locos ( e-mail: )
Lunes 22.02.2010 / 03:57
na pos pinches cnc son culotes y nomas asta asiç hbo los cocha

AK47 ( e-mail: )
Lunes 22.02.2010 / 02:34
AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!!

AK47 ( e-mail: )
Lunes 22.02.2010 / 02:30
AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! Ae

acgg! ( e-mail: )
Domingo 21.02.2010 / 15:26
sanTANITAAAA LOKOSSS! ACg es el sello ke yebamosss ai tamoss mi warerr !

warERoNEE! ( e-mail: )
Domingo 21.02.2010 / 15:19

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 11:20

( e-mail: rpssCREW! )
Domingo 21.02.2010 / 09:40

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:23

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:20
jajajaja se los cochan los adn 38 ay estamos puestotes pues caiganle cuuuuuuuuuuuulos pcl

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:15

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:11

Cesar ( e-mail: )
Sábado 20.02.2010 / 16:49
Que tal putos arriba las chivas van 7 al hilo y como siempre barrio londres de la 31 de chihuahua los mas H... ones juntos con el 725 de juarez putos

gabo ( e-mail: )
Sábado 20.02.2010 / 16:44
arribbba las chivas y arriba el norte de la 725 apooco no locos el gabooooo!!!!!!!!!!!!!!!

sckot ( e-mail: )
Sábado 20.02.2010 / 16:40
un saludo desde camargo del sckot alos pcl de todo juarez los kocha de rato los huacho sigan grifiando y fifando ya se la saben dentro d 2 meses los imbito a pistiar

ESCKOTONER ( e-mail: )
Sábado 20.02.2010 / 16:23

( e-mail: )
Sábado 20.02.2010 / 16:19

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:16

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:12

el DAFE ( e-mail: )
Sábado 20.02.2010 / 16:11

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:03

HeLiO!pb7! ( e-mail: )
Sábado 20.02.2010 / 14:33
simOn lo q digan weies jaja BARRIO SIETE se los QOSHA!

astaaalaMUERTE! ( e-mail: BJL )
Sábado 20.02.2010 / 14:03

ADN 38 ( e-mail: )
Sábado 20.02.2010 / 10:34

( e-mail: jarudoteeLOOKOS! )
Sábado 20.02.2010 / 09:05

sckot ( e-mail: )
Sábado 20.02.2010 / 08:18
725 dominando las calles de juarez no como los adn solo ablan y no pintan ni se suenan y ay se andan dando fama falsa zZz atte hak hard cores art chiwas graff

raacK ( e-mail: raacK_ABC )
Sábado 20.02.2010 / 04:43
ee pinche gato no estes mamando wey ke no noams porke estes mas longo kle yo y ke unos k otros pienses keke kna no save ke pinche kolor se karga la trifulka we mejor dele leveraund we esas M... son de morriyyos las cosas se dicen en la cara we

b jarudo loko ( e-mail: ptks 13 )
Viernes 19.02.2010 / 14:13
los del siete k simpre kon la misma ropa k no mamen de rato les mando una despensa pinche jodidos komo me da risa la pinche gente jodida tan P... jajajjajajajajja

ADN 38 ( e-mail: )
Viernes 19.02.2010 / 12:36

ɢαтнчCк•вʟαCк•σɴєss! ( e-mail: ɴɢŁк™•вктα sυг•σɴєs! )
Viernes 19.02.2010 / 07:29
cke tranza lockos un saludo pa los homithos cke no nos dejan morir jaa! i un saludosky pa los grafer's jaa! ora pz pongansen vergas los badboys i los ycw van a valir V... weyess!!!!

chuy ( e-mail: culos )
Viernes 19.02.2010 / 04:15
e no mamen con sus pinchis M... esas se dan abajo pongancen a trabajar putos soy el clow de los terrenos 13 de la heroes de la rev. putas de M... muerance todos el clow rifa y controlan terrenos 13,pbt13 RW el sock frow owel owner rifan unidotes chida acuerdencen que los terrenos son los mas pesados de cd juarez

el clow ( e-mail: )
Viernes 19.02.2010 / 04:10
los terrenos 13 el clow rifa y controla la heroes de la rev.

( e-mail: DSD!!BJL!!ONES!! )
Viernes 19.02.2010 / 02:55
ayva el saludote pa los jarudos lokos dsd!!!!!656 gente navegando!!!! arre homies firmes

ADN 38 ( e-mail: )
Viernes 19.02.2010 / 02:43
adn 38 controlando

CANGRYS CREEW ( e-mail: jarudo yesk cangry creew )
Jueves 18.02.2010 / 21:03
Qee nadiee le manda saludo aloos cangry crew del jarudo no ps io me mandare solo un saludo para los cangri del jarudo att yesk los amoo rps lbp gsp DSD tps13 y ptks 13 de jarudo ii un saludoo para el snafodonga de la rps

( e-mail: JARUDOTE! )
Jueves 18.02.2010 / 11:40

( e-mail: )
Jueves 18.02.2010 / 11:35

AURORA ( e-mail: )
Jueves 18.02.2010 / 10:28

doser y el foster ( e-mail: )
Jueves 18.02.2010 / 10:24

( e-mail: )
Jueves 18.02.2010 / 04:11
k royo pinchis lomeros culos a la V... pinchis cucarachos de M... del 7 pinchis vatitos culos

ADN 38 ( e-mail: )
Jueves 18.02.2010 / 02:57

ADN 38 ( e-mail: )
Jueves 18.02.2010 / 02:54

JaRUdoOo ( e-mail: DrAk )
Miércoles 17.02.2010 / 17:04
ke rollo putos el jarudo rifando y controlando BJL EL DRAK SE LOS COCHA UN SALUDO para el LADO BAJO PELIGROSO .

risas ( e-mail: cnds 12 )
Miércoles 17.02.2010 / 17:00
ke tranza putos el risass de los condes 12 cocha

HeLiO!pB7! ( e-mail: )
Miércoles 17.02.2010 / 16:08
duuuu!! jaja pinshee meqO, BARRIO SIETE QOSHA!

( e-mail: adonde no llegaran )
Miércoles 17.02.2010 / 14:43
KE H... geen assuuu MADRE loss KE noo se vañññaann ( abber si no le caiiii el sako alooss DEL 7) JAJAJAJA! pinnchiss roñossoos

sckot ( e-mail: )
Miércoles 17.02.2010 / 13:35
dominaran en su casa peropero roma no a de asco d de dan lastima y n de no valen V... pcl saludo a los 727 y a los 725 siga rrapeando my weat y sigue de loco sprock

angel ( e-mail: )
Miércoles 17.02.2010 / 09:18
H... en asu madre todos los barrios de juarez y mas los del jarudo puro punetas puros karnales ese

( e-mail: ABL )
Miércoles 17.02.2010 / 01:39
un saludo a los del jarudo.conosco a 2 k 3s de ace anos k kayeron al tribilin el kem,el chato y al momia camaradas chidos k le salen x su barrio. aber si nos volvemos a guashar de rato cabrones.desde la ALTA VISTA LOKOS EL CESARONE!!!

ADN 38 ( e-mail: )
Martes 16.02.2010 / 12:22

sckot ( e-mail: )
Martes 16.02.2010 / 11:53
H... en a su madre los adnacos y un saludo alos 725crew y los 727 roma y alos pcl dela divilocotes rifan esckotonersotestar.

( e-mail: )
Martes 16.02.2010 / 07:59

clow ( e-mail: )
Martes 16.02.2010 / 02:49
el clow de los terrenos 13 cochan de la heroes de la rvolucion putos trns13

SUENOKER ( e-mail: SUENOkerone )
Lunes 15.02.2010 / 11:44
el unico barrio mas H... on es SWK SOUTH SIDE LOCOS el SUEÑOKER rifa putos

( e-mail: )
Domingo 14.02.2010 / 04:15

ADN 38 ( e-mail: )
Sábado 13.02.2010 / 12:38

jairo ( e-mail: )
Viernes 12.02.2010 / 03:14
jajaja graffiti a qui cas nadie ase ai q aser una pinta myspa Jsomer2008@hotm aver si se ase atte kfc crew

skoR! FREDY! ( e-mail: HACIENDAS14.JL! )
Viernes 12.02.2010 / 02:28

( e-mail: )
Jueves 11.02.2010 / 13:17

CHOLITO ADN 38 ( e-mail: )
Jueves 11.02.2010 / 12:35

( e-mail: )
Jueves 11.02.2010 / 10:47

( e-mail: )
Jueves 11.02.2010 / 09:58

SUENOKER ( e-mail: SUENO )
Jueves 11.02.2010 / 09:49

( e-mail: )
Jueves 11.02.2010 / 07:23

( e-mail: )
Miércoles 10.02.2010 / 17:25
un saludo `param compa el yesskarmeloo jajajaja de parte de el snaf y ia no te juego canicas por ioras cuando te ganoo y me las quita tu mama jajajajaja y aii tamoos el snaf de la RPS jajaja arre chiido pi yeskarmelo

( e-mail: el yesk uno bjL )
Miércoles 10.02.2010 / 17:23
el yeesK uno amaa a snafodonga de jarudo un saludo para mi amigo snaf qe le gusta jugar musho alas canicas aver cuando nos aventamos un partido de tasos mi snaf el yeesk del jarudo locos los cangry creew

ADN 38 ( e-mail: )
Miércoles 10.02.2010 / 03:16

el pappy ( e-mail: paso tx.2 barrio )
Miércoles 10.02.2010 / 03:03
k tranza shina de k barrio eres mija.nesesito a alguien como tu con huevos!!! i like that.girl!

SynaaONEE ( e-mail: )
Lunes 08.02.2010 / 14:57
Laa ShynaaONER Riffandoo & QontrOlaandoo awaao paapa SHYNAA ONEER Laa moomy dee tdaas Uzteedees QuLAaZz! VAA PARAA LAA PINCHEE LAADY CELEESTE MICHEL CELIA DIANA PAOLA Y LA PUTA DE FANNY

el zamarripa ( e-mail: )
Lunes 08.02.2010 / 06:28
ke pedo ala berga todoz me la perzinan

BjL snaaf RPS ( e-mail: )
Domingo 07.02.2010 / 17:29
buenoo aquell q me dijoo un chiingoo de cosaas q el snaf q prometia sangre y asii q venga el y lo demuestre o q preste el cuete por q aqui en el barrio sii hay huevoos por donde sea ok ia estamooos y aii toii para lo q quieraan chiida ia si quieres desirme cosas aqui esta mi msn bjL loka aunq les caleee 656BjL

eL VeeRgUiiLLaS cOcHaa ( e-mail: )
Sábado 06.02.2010 / 13:48
si se cren muii vergas todos amos a desmadrarnos aqi les dejo mi msn culones para q me agregen para q vean q no soii qulo

eL VeeRgUiiLLaS cOcHa ( e-mail: )
Sábado 06.02.2010 / 13:45
a la V... todos los qe aqi aqi qon mi gente la qeqe jazmin choii zamarripa los cochan putos pinchi gente jodida qomo me da risza q nomas pierde su tiempo aqi en estas mamadas

kekeo ( e-mail: )
Sábado 06.02.2010 / 11:42
k ijos de perra los pcl son de agua ia los desmadramos una bes puro brg rifando y controlando y los pcl k H... en a su madre

( e-mail: JARUDO.L )
Sábado 06.02.2010 / 11:23
chida pa todos los barrios k nos respetan c les retacha la copa..y a los k no H... en su madre x eso les segimos pateando el C... BBBBBBBBBBBJJJJJJJJJJJJJJLLLLLLLLLLLLLL!!!!!!!!!!!!!!!

bjl ( e-mail: jarudones )
Sábado 06.02.2010 / 11:18
si los perros ladran gente es x k vamos pa delante.digan todas las M... k kieran.cuando tengan huevos ya saben en donde estamos kaiganle putos!!!!! barrio jarudo lokos

sanFRANCISCO ( e-mail: chidasJARUDOS )
Viernes 05.02.2010 / 16:00

v.i.p. ( e-mail: jarudo lokos )
Viernes 05.02.2010 / 12:32
arre gente ya pa H... ados se echan dejen q los P... se luzcan para q sepan q nos la pelan para q vean la calidad

jarudo lokos ( e-mail: cgk )
Viernes 05.02.2010 / 12:29
tranza gente arriba jarudo

( e-mail: )
Viernes 05.02.2010 / 09:06

q lokooo ( e-mail: )
Viernes 05.02.2010 / 08:39
un saluduiyo amis kompas k andan paradotes al daiki i al biwor dela echbikei.. k nole rajan.. hbk je d morrelus 12 23

( e-mail: bjL )
Viernes 05.02.2010 / 08:08
SSSI les kalaaa ALOS ojeettes dee MIEERDA hahah!

( e-mail: )
Viernes 05.02.2010 / 07:04

( e-mail: )
Viernes 05.02.2010 / 06:29
ese pinche kulero de abajo el k se la pasa ablando de los jarudo de aora k diga su pinche apodo kulero no k nosotros somos lod kulos k valga V... kulero aki la raza piteka kulero

( e-mail: bJL )
Jueves 04.02.2010 / 14:30
USTED calleseee i ballasee munnccho ala BERGHAA weiii usteedddes soonn looss qq ESCRIBENN esass madresss weeiiies haha quiereeenn agarrrar FAMA levantarsee qon nuestroo barriooo JAJA! qq pendejoss neettaaa

HeLiO!pB7! ( e-mail: )
Jueves 04.02.2010 / 14:02
jaja ia bn los mismos de su barrio lo dicen eL barrio SIETE siempre los a qOshadO! q wei aOra anda en su pinshi barrio soLo a pie ii son requLos les decia del siete ii no me decian nada jaja BARRIO SIETE QOSHA!

KONDOR ( e-mail: )
Jueves 04.02.2010 / 13:21

KONDOR ( e-mail: )
Jueves 04.02.2010 / 13:17

soy el ysto ( e-mail: )
Jueves 04.02.2010 / 12:14
soy el ysto de aca de las cruces NM i ailes va una dedicasion para los adn que andan diciendo P... fuck you the one that is writting that bull shet y sino me entienden usen su pinche diccionario P... C... y nosotros traemos el arte del graffiti en la sangre pcl crew 725 graffiteros H... ones un saludo para los carnales delas calaveras 38 del roma para el chito alias el creo

soy el ysto ( e-mail: )
Jueves 04.02.2010 / 12:11
soy el ysto de aca de las cruces NM i ailes va una dedicasion para los adn que andan diciendo P... fuck you the one that is writting that bull shet y sino me entienden usen su pinche diccionario P... C... y nosotros traemos el arte del graffiti en la sangre pcl crew 725 graffiteros H... ones un saludo para los carnales delas calaveras 38

( e-mail: )
Jueves 04.02.2010 / 10:16
guachen mis jurudos nadie me ha dicho por aki que arre vamos a aser el desmadre o vamos a juntarnos todas las crew para aser el desmadre y que valga V... con los lomeros de kk pero nadie esas M... que a agarrar la vieja escuela no mamen si nisiquiera le salimos vamos a agarrar los wevos gente y que valga V... pero neta no M... y tu klen ya callate wey demuestra con echos no esperes a que se metan al barrio ay que meternos nosotros para sembrar el panico y ya que deveras nos tengan respeto y vamos con toodo gente mas con esos C... del 7

( e-mail: )
Jueves 04.02.2010 / 08:31

( e-mail: )
Jueves 04.02.2010 / 07:14

( e-mail: )
Jueves 04.02.2010 / 06:28
este pendjho d abajo q? si vas a poner k ponga su apodo pos ponlo tu tambien wey no seas PENDEJHO y CULHO

Jueves 04.02.2010 / 05:59
EXACTAMENTE weeiii no qeremoss serr qomo loss de annttes no qereemos aserle ala mierddaa weii NO qeremosss andaarrr de pincchis tecatooss weii qoomo no poness tuu pinncchi apoddoo qulero PINCHI mierddaa aber si es vdd q mui BEGHAS hahaha nomas ablann weiiess perroo io see KEE usteddes no balenn BERGHAA. & nooo tirroo mii RROIOO weeii perroo loo bamoss a demostraarr QON ecchoss weiii paraa serrarless EELL OSICO

( e-mail: )
Jueves 04.02.2010 / 03:36
jajaj jarudillos no treten d compararse con los d antes k nunk ban aser como eyos, entiendan k se les acabo el teatrito ya todos sabemos k no son nada. y pueden segir tirando su royo sikieren alcabo ya sabemos como corre el awa y no valen verga. los dl 7 siempre los an hecho d agua ya aceptenlo no la arman!

HeLiO!pB7 ( e-mail: )
Jueves 04.02.2010 / 03:22
jaja nos peLan la vErgaa! BARRIO SIETE!

bjl.rifa ( e-mail: )
Jueves 04.02.2010 / 01:57
yo c k los longos eran un desmadre y H... ones le salian donde kiera x eso les tenian miedo..amos agarrar la vieja eskuela gente .arre!! jarudote lokotes....

somos uno solo ( e-mail: juntense gente )
Jueves 04.02.2010 / 01:54
k royo gante no sean P... no ay k peliarnos entre nosotros. Atodos esos kuleros k an hablado de nosotros es x corage.diganlo de frente si tienen guevos .Nada mas sirven pa kriticar pinchis culos....BBB...JJJ...LLL...XEVER!!!!!!!!!!

( e-mail: )
Miércoles 03.02.2010 / 14:40

( e-mail: )
Miércoles 03.02.2010 / 13:25
que tranza yo soe del jarudo quiero que tumben a alguien del 7 y demestren que en verdad nos pelan la vvergga... ya es hora de demostrar que sigen siendo jarudos..porque hay muchos que lo tiran pero hay pocos .. jarudos lockos..

EL GRATE ( e-mail: )
Miércoles 03.02.2010 / 11:55

thE WeSo ( e-mail: )
Miércoles 03.02.2010 / 06:48

( e-mail: jarudo locos )
Miércoles 03.02.2010 / 05:32
ya pues para qee vergas nos estamos peliando entre el mismo barrio ii las diferentes crews del barrio ia no ai q ablar demas ia savemos q nos traemos corajes varios del barrio ii nos emos trensado C... pero ni pedo vamos a unirnos otravez como antes ia ala V... no ai q ablar nomas actuar ala vergaaa esta P... pagina iaaa

( e-mail: )
Miércoles 03.02.2010 / 04:12

JARUDO LOKOS ( e-mail: )
Miércoles 03.02.2010 / 04:05

altavista!!! el actoo ( e-mail: )
Martes 02.02.2010 / 14:05
simon es la mera neta yo conoci a los jarudo a los longos hace un H... o le caian para aca a conectar y esos weyes si le salian eran H... ones pero los de hoy en dia de ningun barrio le salen la neta andan con sus M... de andarse drogando machin y ya ni le salen por el barrio la neta son puro pinchi chavillo fresilla que nomas porla compu pueden y si kieren calarse arres soy el acto de aki de la altavista !!!!

ADN 38 ( e-mail: ADN 38 )
Martes 02.02.2010 / 12:03

( e-mail: )
Martes 02.02.2010 / 10:04
nettaa KEE ssiii weii esttoii qonn tiiggoo battooo PARA empesarla loss kanngrii wei aseenn JARUDO a puroo pinncchi MARICON qq no bale berghaa ala brabaa weii nettaa weii puro pinnchi MARICON

( e-mail: )
Martes 02.02.2010 / 09:57

( e-mail: )
Martes 02.02.2010 / 09:48

Martes 02.02.2010 / 09:09
chinngeenn atodaaa sssuu puttaaa madreee pinncchisss cagadooss nettaa weiies. ssii el jaruddoo eraa verghass anntes lo bbbaa a serrr OY ii siemmmprreee puuttoosss ABER ABER i usteddes q berghas isiseron por la muertee del pelonsillo ijoss de la verghaa aaiiTA siigeenn sienndo loss pinnchis tecatoss KE no valen BERGA ni balieron berghaa puutooss rpsslbp.QONTROLANDO puutooss somos los unikos ke le salimoss IJOS de la berga asii qqq no no salggaannn QON mamadddass PINCHIS pendejoss.

( e-mail: )
Martes 02.02.2010 / 06:20
soy el ysto de los pancon leche mejor conocido como el andy en el roma pura gente de los pcl crew 725

( e-mail: )
Martes 02.02.2010 / 02:38
simon si es cierto donde esta la venganza del pelon? ustedes nunka isieron ni madre, y yo no soy de los longos ni les tengo miedo si no pongo mi nombre es porke no se me da mi pinchi gana, y la neta antes si era un barrio H... on aora no vale madre ni pork son un putero el otro dia supe ke los del 7 isieron de agua a los jarudos no mamen k verguensa neta k me awitan gente

viejas renciyas ( e-mail: BIP )
Martes 02.02.2010 / 02:24
hola danny!! k t as esho pense k ya estabas muerto. komo eras un ijo de tu P... madre vale V... tu y tu barrio jarudo..donde t fui a encontrar....toda via me la debes P... al rato m sako la espina cuidese culero..atte B.I.P

( e-mail: )
Lunes 01.02.2010 / 14:34

( e-mail: jarudo locos )
Lunes 01.02.2010 / 09:41
otra cosa sqee stan bien cagados ii noles cuentan las riñas qe asemos ii ai les encargo qe jarudo no nomas son los lbp stamos los rps cangri tapias 13 dark side pitekos 13 green side ii cada qien ase su desmadre aparte ii para esos culos q nos ponen cosas aver como no disen qienes son por algo nos tienen miedo cagados jarudo todabia lo segimos levantando ii asiendo riñas por el no nomas ablamos por aqi ia an visto eshos para q no digan q no nomas ablamos

( e-mail: jarudo locos )
Lunes 01.02.2010 / 09:37
vallanse ala V... putos ustedes los pinches longos ni saven cuando asemos las riñas no saven lo q asemos por el pinshe barrio lo levantamos por todas partes asta por compu nosotros si tenemos amor por el barrio ..

( e-mail: )
Lunes 01.02.2010 / 08:57
simon ise wey tiene rason los jarudos de orita ya son bien culotes no se conparan con los de antes si e cierto k se la pasan drogendose pero porke a eyos ya les bale madre, pero antes si asian desmadre chidote en cambio los de ahora nomas tiran su royo y nunk asen nada, nomas wachen al klen k se la pasa tirando su royo por internet en ves d andar afuera aciendo riña pinchis chabos colos tira royo me awitan pff

BJL ( e-mail: )
Lunes 01.02.2010 / 07:08
hahaha NOSS deciaann de acholee II QORRIAANN puutooss hahahaha sonn deee aguaa putooss i essoo qq nommass eramosss 2 nommasss 2 hahahahah i ustdddes qomo 10 no digas qq NO puutto hahahahaha.-ssonn de AGUA-

HeLiO!pB7! ( e-mail: )
Lunes 01.02.2010 / 05:39
jajaja 15 no mames de primero eramOs 2 i ustedes qomo 8 i los isimOs de agua! despues los dejaron morir eramos 2 pa 2 i se qulearon de a shole! i siguieron de aferradas sta q me desqonte al stiq jajaja BARRIO SIETE!

losJARUDOTELOKOS.- ( e-mail: )
Lunes 01.02.2010 / 04:41
hahahahah SIMON puraaa pinnccchii ABLA eraa para kee noss ubieran eccho para atrasss i all CONTRARIO no losss QOMIMOS qomoo sieemmmprreeee hahaahahahahaha PINNCCHI ELION VOZ DE PITTOOTTEE Q tiiennnes weii pinncchi MARICON DE mierddddaa.

JARUDO LOKOS ( e-mail: )
Lunes 01.02.2010 / 04:07

( e-mail: JARUDO CHICOS )
Lunes 01.02.2010 / 01:16
ii ala vergaa todos los putoos entradoos sigo esperando por años a un pinche barrio qee tengo los webos de meterse a jarudo a aser la riña pero nadiee son cULOOS ia con eso los caLLoo putos vamos a ver qee barrio tiene de meterse al barrio a piee como nosotros lo asemoos nosotros ni asus mamas respetamos ii no es bla bla simplemente son eshos qee ustedes an vistoo

hahaha ( e-mail: JARUDO CHICOS )
Lunes 01.02.2010 / 01:10
no nomas le sali por la compu cagado los shicos somos los qee estamos levantando el jarudo pinshes longos ia son bien culones nomas se la mantienen drogandose nosotros somos los qe traemos el desmadre putos por algo todabia stamos en zona roja ii eres culon weei por algo no pones tu apodo POR CULOOO hahahahha ponga el apodo cULON para qee vea q los shicos tambieen nos abrimos si ia emos de eshoo DE AGUA ALOS LONGOS

HeLiO!pb7! ( e-mail: )
Domingo 31.01.2010 / 16:10
jaja oii los isismOs de agua putOs barrio siete qosha pinshis jaroshas!

( e-mail: )
Domingo 31.01.2010 / 14:42
la lbp del jarudo son bien culos yo cantoneo en el jarudo nomas ablan y ablan que lastima pues los cholos de antes que cantoneaban aqui en el jarudo esos weyes si que mis respetos no como los de aora son bn culos nomas ablan y ablan pobres espero y algun dia mi gente del jarudo si agarre los huevos y de nuevo agarre fama no nomas por computadora que sea por echos no con bla bla bla

el de abajo!!! ( e-mail: mil diskulpas!!!! )
Domingo 31.01.2010 / 10:54
mis diskulpas a todos lo ke entren en esta pagina lo ke esta eskrito abajo es algo de mal gusto ke eskribio mi hermanita de 5 años eske es muy imperactiva, y agarro la kompu kuando yo estaba en el baño me tarde por eso tuvo bastante tiempo de hecho no es la unika pagina ke insulto si no otras en otro idiomas el habla 8 idiomas me kae mal... neserio pido una diskulpa es mas una diskulpa en nombre de todos los meseros del mundo a no vrd??? jejejejeje, el nombre de mi hermana es mela y se apellida pelas si kieren deskitense kon ella la odio me kito todo lo ke tenia en la vida jajajaja matenla ya"!!!!!!

ke te importa wei!!! ( e-mail: )
Domingo 31.01.2010 / 10:47
ke pedo pendejets!!! todos los ke stan leyendo estos msn son unos idiotas sin ke hacer. babosos, jajajajajajajaja yo no porke soy el creador de sta pagina stupidos y gracias a animales komo ustedes gano mucho dinero en la komodidad de mi apartamento jejejejejejeje jente idiota solo en mexico klaro yo no soy d aki jajajajajaja graxias a dios!!! a y sigan escribiendo porke mire una tv plasma ke me kiero komprar aber si se ponen las pilas ke akabo en la eskuela valen madre no hagan las tareas,,, asnos!!!!

BJL. ( e-mail: )
Domingo 31.01.2010 / 06:20
esperate esperatee weii TUKE asi de peladdass weii ATI nadiieee te conocee weiii jajajaajaja pinncchi chavala cagaddaa jajajaja-WACHA AL pinncchi dosill preguntale qomo lo kuliamoss al KULERO eenn prebiass weii hahahaa qq llaa ni durmioo en toddaa la nochee porr ell miedoo hahahahahaa.. PINCHIS CULONNES.hahah tambieenn cuannddoo calleron aa la iglesiiiaa qonn el estupidoo maricon del navi hahahaha no weiies llaa tiren alionnn asii desiann vdd QULONES hahahahahaha BBAARIOOOJARUDOTELOKOS! isomoss chabilloos perooo MMMMM.. noss pelann laa verghaa puttoosss jajajajajajaja. PENDEJOS.

Domingo 31.01.2010 / 06:03

Domingo 31.01.2010 / 05:49

SCOR BJL HPL14 ( e-mail: )
Domingo 31.01.2010 / 03:31

HeLiO!pB7! ( e-mail: B7 )
Sábado 30.01.2010 / 15:55

JARUDOTE-1 ( e-mail: BJL )
Sábado 30.01.2010 / 14:43
hahahahahhahahahahahahhahahahaa.pinncchiiss unidoosss qomo tirann ssuu puutttoo roiooo porrr internet weiies hhahaahahahahah BAMOSS ABBER QUIEENN ESS MMASS BERGHASSS PUTOS BBARRIOJARUDOTELKOSLA CUESTA!JARUDOTEHACIENDAS!UNOS.hahahahahaa pinncchiss quiernnn qq mmee mettaa asuu puuttoo barrriiooo otraavves A AGARRARLOS A TUBASOOS HAHAHAHAHA pobrres roñossoos hahahahahaa.

BJL ( e-mail: )
Sábado 30.01.2010 / 09:37

MuUk!14 ( e-mail: unidotes 14 )
Sábado 30.01.2010 / 08:29
para el esckor del jarudo ya valistes V... P... neta P... enffierraz a chavitos que no la deven ni la temen como no me enfierrastes a ami o al difo neta wey se me va amarrar por cke ya valistes V... P... este chaviyo tenia una madre que se avia echo unidos y tu le caistes a el pero el papa de el es mexicles y te va a matar pinche perro lambe bolas pinche flaco C... ijo de P... y na no le paso nada ni para enfierrar sirves wey neta

adrian_hiphop ( e-mail: )
Viernes 29.01.2010 / 14:13
el mc manhy kanta bien feoote.. nole da verguenza al wei no eres apto igual q los raperillos de aqui d juarez no la cuajan

( e-mail: )
Viernes 29.01.2010 / 12:26
pinche elio como tiras tu P... royo we sabiendo ke me pelas la V... tu i tus pinches terrosos puto JARUDOTE LOKOS EL STYK HIJOS DE SU PUTA MADRE

( e-mail: )
Jueves 28.01.2010 / 13:37
mmee TIEENNES asttaa laa berghaa IJO DE TU PUTA MADRE ttee voiii a seerraarr el puutto osiiccoo KE tiennnes weii quannddoo veasss alasss calaccasss kkee mee voiii a AVAENTAR IJO DE TODAA TU PUTA MADRE . DEL jarudoTELOKOS!

HeLio!pB7! ( e-mail: )
Jueves 28.01.2010 / 12:31
mushO pinshi bLa bLa weies i no hacen ni madres pinshis jarOshas! B SIETE!

( e-mail: )
Jueves 28.01.2010 / 10:01

( e-mail: )
Jueves 28.01.2010 / 07:38

FReAck ( e-mail: )
Jueves 28.01.2010 / 05:45
aii les ban estas cuntas letras a los pinches cholos k kieren ser komo yo ustedes son culos ....mmm puro b.TENERS 15 nortenos el freak los cocha

( e-mail: jarudos locos uno )
Jueves 28.01.2010 / 04:51
estan pero si rebien P... tibursios culoos nosotros los mandamos ala V... cuando callo el netin no los desmadramos por caernos a mamar las bolas a jarudo para qee qeremos mas terrosos nunca se les ara tener el acople con nosotroos

( e-mail: )
Miércoles 27.01.2010 / 12:08
jajajajaja aki los tiburones rifando y controlando las calles de juaritos jarudos y sieteros no valen verga ya se la saben putos

( e-mail: )
Miércoles 27.01.2010 / 11:59
jajajaja pinches jarudos culos ustedes desian hamos a unirnos para darle en la madre a los sieteros jajajajaja pinches batos lambe bolas jajajaja

( e-mail: )
Miércoles 27.01.2010 / 11:52
k pinche chato me la pelas jajajajajaja mamando tu tambien a otros barrios no k solos pueden jajajajaja pinches chavalas

( e-mail: )
Miércoles 27.01.2010 / 10:53
jajajaja pinches sieteros C... eses pinche barrio cagado siempre los asemos garras putos saben bien a puros escopetasos acuerdense putos les da miedo acordarse jajajaja miedo es entrar al barrio de los tiburones jajajaja

( e-mail: )
Miércoles 27.01.2010 / 06:48

( e-mail: )
Miércoles 27.01.2010 / 06:27
aiiPINCCHII roñosooo jajajaja:) qomo esttass CAGADOTEE pinncchii elio nettaa weiiiHAHAHA. tmbb pinncchis tiburoness qomo NOS DECIAN no jarudoss porfaboorr arrree a UNIRNOSS asttaa caian al barriooo NOSEACUERDAN puttooss hahahahan BARRRIOOJARUDOTELOKOS CONTROLANDO LA CUESTA!

( e-mail: )
Miércoles 27.01.2010 / 05:18
el gobierno y los poli son rameras!! y aun asi con su respeto... por venderse!!!

dick ( e-mail: )
Miércoles 27.01.2010 / 00:33
que rollo putos aqui el dick desde el bachi saludos a todos los adn del roma y de la 8 cuidense atte. el dick

HeLio!pB7! ( e-mail: )
Martes 26.01.2010 / 14:17
jaja mamando barrios iguaL q los jarudos no mamen aprendan a nosotros weies no mamamos a nadie nosotros solitos podemOs BARRIO SIETE SEGUIRA QOSHANDO!

HeLio!pB7! ( e-mail: )
Martes 26.01.2010 / 14:12
jaja a qien le dicen roñonos pinshis tiburones estan mas pinshis jodidos q todos weies ii ai andan qreiendose los vergas jaja BARRIO SIETE QOSHA!

( e-mail: )
Martes 26.01.2010 / 10:51
saludote para los unidos 14 al muk de los tiburones 13

( e-mail: )
Martes 26.01.2010 / 10:46
para los roñosos del siete bajo 13 y para los jarudos culos k siempre nos an pelado la V... C... saben bien tiburones13 rifando y controlando las calles de juaritos pocos pero locos matamos y enterramos y si nos buscan en la andres figuroa estamos jajajaj barrio tiburones rifando y controlando

( e-mail: )
Martes 26.01.2010 / 07:58

( e-mail: )
Martes 26.01.2010 / 07:33
B:batos J:jodidos y L:lomeros pinshisss jotorudoss

skiw ( e-mail: )
Martes 26.01.2010 / 06:44
k rrollo culos

jarudo hacciendas ( e-mail: )
Martes 26.01.2010 / 04:22
orasy ya valio V... abra torturas y abra el infierno palos entrados neta ya valieron verga!!! ijos de su pinche madre!@!!!!

( e-mail: )
Lunes 25.01.2010 / 07:51

Pamela Gonzàlez ( e-mail: )
Lunes 25.01.2010 / 04:29
Hola!! Soy de la revista Graffiti de Mina Editores, estamos en busca de organizaciones y marcas que estèn relacionadas con la cultura del Graffiti para intercambiar informaciòn sobre nuestros espacios publicitarios. Dejo mi correo para q se comuniquen. Saludos

( e-mail: )
Domingo 24.01.2010 / 13:45

@cme ( e-mail: )
Domingo 24.01.2010 / 08:59

( e-mail: )
Domingo 24.01.2010 / 01:16

el s@iko reportandose junto k ( e-mail: )
Sábado 23.01.2010 / 14:20
pinches vatitos de M... lo q quieran decir diganselo en su kara P... q es eso q dejando rekaditos neta q parecen P... eskribiendose H... adera y media pinches barriesillos de M... puros pachukos 30 rifa y kontrolan todo juaritozzzz

pitonisio ( e-mail: )
Sábado 23.01.2010 / 10:23
verga grande al 6-69-69-69 llama aoraa!!!!1

( e-mail: )
Sábado 23.01.2010 / 04:05

BJL.UNOS ( e-mail: )
Sábado 23.01.2010 / 01:45
haiii poorrrDIOSS quienn tiennnee miedoo PINNCHI LOMERO esmmass weiii!! tuuuKEweii esperatee esperattee NADIEN te CONOCE weiii jajajajajaj MIEDOO HAHAHAHA NOMMMASS ESPERATEE POKITOO PINNCCHIII ROÑOSO MEQO!!

HeLio!pB7 ( e-mail: )
Viernes 22.01.2010 / 15:55
uii q miedo jaja no mamen jaroshillas tienen dicendo eso desde q me aquerdo i mira es ora q nomas no, tienen MIEDO de tronar un quete jaja BARRIO SIETE QOSHA!

( e-mail: )
Viernes 22.01.2010 / 12:20

shiinaa Onee ( e-mail: )
Viernes 22.01.2010 / 07:35
Paaraa tii amoorr

catorce wet side family ( e-mail: )
Viernes 22.01.2010 / 06:04

( e-mail: bjl la cuesta bjl haciendas )
Viernes 22.01.2010 / 04:18
y un saludo para los otros jarudos de haciendas saben bien en distintos lados stamos pero somos lo mismo les asen algo a ustedes nos los asen a nosotros shida family..

( e-mail: jarudos locos )
Viernes 22.01.2010 / 04:13
deja tu messenger keem para agregarte los del barrio si por aca todavia eres leyenda save bien q se le recuerda por piraton

bjL ( e-mail: wesk del jarudo )
Viernes 22.01.2010 / 04:10
como tiras roio axer neta weei no se por qe tiras tanta caca si saves bien que mi pinshe barrio te dejo cojo ii aparte te enfierraron ai stabas llorando cuando te atropellamoos lastima das shavo nomas puro bla bla con tigo ii los del siete ia ni train nada ia son como 10 weies ii nosotros entramos ii salimos ii a PIE caminandola por su pinshe barrio jediondo no la caliente P... q se le cai al canton junto con su carnala pinshe barrio jediondillo entro ii nomas miro las placas de jarudo por tu pinshe colonia asqerosa ustedes ia murieron ia ni existeen

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 03:37
ese mi gun chida x las liricas de tus rolas.sigale asi kabron. ya se la saben con JARUDO no se entren putos!!!!!!!!!!!!!!BJL

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 02:27
ay les va un saludo pal tatus,mayelo,los cuates,el conejo,pancho,chikles,rojo,gus,maiko,gory,cholo,pulga,cheko,el chino,mostro,mata,emilo,jimy,spek RIP,lyos,chuky,y a todos los veteranotes deay de las canchas del BARRIO JARUDO LOKOS!!!!!!!!!!!!!!!!!!!!!!!

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 02:07
k tranza jarudos! k le paso al gordo.tirenme el royo.kiero torikiar kon el duke o el nomi eyos ya saben kien soy....desde la frontera kabrones BJL controlando!!! REST IN PEACE EL AYEM#1

( e-mail: )
Jueves 21.01.2010 / 15:37
el draw delos msf eres un pendejooo pinchhe mokoso stupido no saves ni lo qe dises tu i tu pinche barrio cagado me la pelan ,, P... son una M... para el dafy... rip dafy!.. elrockaone! cuando qieran putos...

( e-mail: )
Jueves 21.01.2010 / 09:07
HAHAHAHHA pero no loss esperaremoss perrraa asta su putoo canntonn para q se me cagenn IJOS de la bergggaa HAHAHAHA BJL

axerone ( e-mail: )
Jueves 21.01.2010 / 08:37
jajajajaj ke miedo wey sabes bien ke a ustedes asta les da miedo tronar n cuete pinchis nogaleros cagados caiganle pero si les matamos otro nomas no pongan demanda chavalitas y con ke ban a venir a matar a algien con sus piestolas de tubo de gas natural jajajajajj no mamen weyes ustedes matan a algiien y se trauman toda su vida el axer y el sego ya llebamos como 4 y nos vale V... no tiramos con pinchis echisas cagadas caiganle aki los esperamos para ke avisaban P... jajajaja ete el axerone

( e-mail: )
Jueves 21.01.2010 / 07:41

BJL. ( e-mail: )
Jueves 21.01.2010 / 06:44

ivan ( e-mail: )
Jueves 21.01.2010 / 03:50
que rollo putos aqui el dick de la adn saludos a los adn pcl culos

EL SPOON PCS1 ( e-mail: )
Jueves 21.01.2010 / 01:28

spoon ( e-mail: )
Jueves 21.01.2010 / 01:21
keee transaaaaaa... eL spoon de tierra nuevaaa.. pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1

el danny ( e-mail: BJL )
Jueves 21.01.2010 / 01:14
1 saludo para paro todos mis homies del BJL! el mandis.wort.maiko.gringo.zeke.impla.fuor.AYEM.. y pa todos los lokos del dark side del JARUDO

danny ( e-mail: jarudolkts )
Jueves 21.01.2010 / 01:03
hey WTF! bitches.jaja. BJL rifa putos

AXERONE ( e-mail: )
Miércoles 20.01.2010 / 16:50

LOW ( e-mail: )
Miércoles 20.01.2010 / 15:13
ADN rifando un saludo para la adn de parte del low

el axerone siete lokos ( e-mail: axerone72hotmail.com7 )
Miércoles 20.01.2010 / 09:40
jajajaj aki riendome de los pinchis mocosos del jarudo ke dicen ke nos kitaron un cuete jajajay une bici esos weyes ni eran del siete P... y dicen ke nos tacharon la placa no mamen entren a pie chavalas nadamas en carro entran al 7 kulotes y no mamen weyes son puros chavillos x eso nadie de mi gente del 7 les hace caso ya neta weyes se les deja ir mi gente y los pinchis jarudos salen corriendo ni las energias gastadas neta x eso mejor ya los tiramos al leon y luego los matan y lo primero ke hacen es poner demanda pinchis shavalas no se amarran debolada se peinan mejor ponganse a hacer otra cosa y dejon de calentarla xke no valen V... nadamas ke no saben aceptar neta el siete los cocha saben bien entren a pie si se cren tan vergas chapetones ke shingados son re culos puros pinchis shavillos de 10 anos neta ke acepten su barrio no vale V... si los del siete kisieranos ivanos asta asus canchas a pistear pinchis placas no las tacho xk me dan lastima se gastan el dinero de l

K-torce west side ( e-mail: )
Miércoles 20.01.2010 / 09:23
hola aqui saludando el lucky de la catorce west side para recordarles que el lado oeste rifa y mandandole una saludo al sid,boss,skiper,zoner y el ecko west side killer

kinterotes surenotes ( e-mail: )
Miércoles 20.01.2010 / 05:39
ala V... todos los putos entrados puro b5ta sur rifa y controla putos somos pocos pero lokos pinches chavalas ya se la saben putos kiinteerootess lookootess (in memori) (of)(el) (kosi)-(devock)kiinteerootess sur (el)(negro)

( e-mail: )
Miércoles 20.01.2010 / 05:28

( e-mail: jarudoo lokoos mas de 150 )
Martes 19.01.2010 / 20:44
ay nomas ago mension de pocos del JARUDO sona duke fath loker wero kako skat mank gringo pancho kuko maico wosk oker free slek smike duda yesk sode phat dial slak soke capi dosil koala duet dies evil wofe gary sonk souk fowe fase poker pulpo pooh shapas piolo omak mink drak cuba klen mago maton fhuor koke impla kef slat skit seck rocka resko shore nomy since stik sholo dikey disa seick wike tomate gun nox june adek kiro harry balak wear moss homi shuky speck snaf skor tek iguana etcetera ya me dio weba pero somos un vergero QUIEN SE QUIERE CALAR ??????

Jarudo mas de 150 cabrones ( e-mail: msfculones )
Martes 19.01.2010 / 20:39
ay nomas ago mension de pocos del JARUDO sona ya me dio weba pero somos un vergero QUIEN SE QUIERE CALAR ??????

Martes 19.01.2010 / 15:14

DRAW ( e-mail: ACG MSF )
Martes 19.01.2010 / 15:06

Martes 19.01.2010 / 15:01

SNEI ( e-mail: )
Martes 19.01.2010 / 11:51

( e-mail: )
Martes 19.01.2010 / 06:41
ayo me kiero meter al certel de juarez tengo mucho huebitos SOY MALILLA PERO YA ME ARTE DE ASER Y MATAR KIERO MAAS DE ESO KIERO SER PODEROSO

el danieloko ( e-mail: )
Martes 19.01.2010 / 03:55
k tranza putos puro jarudo lokos no more! al rato les kaigo x aya gente , no c aguiten. el dani saludando desde u.s

SPHAR CEZ WZ EAC ( e-mail: )
Martes 19.01.2010 / 03:20

( e-mail: )
Lunes 18.01.2010 / 10:01
AII disculpennn ermosooss no eraa esee aii qq tonttaaa ERA losss mamo puedoo chuparr penes tmb

( e-mail: )
Lunes 18.01.2010 / 09:56
AILES bbaa el mioo pappasottes klenbjl8qhotm. loss amo

fabiola ( e-mail: )
Domingo 17.01.2010 / 10:13
holaa ps soi de chihuahua agreguenme a su msn el mio se cuidan

( e-mail: )
Sábado 16.01.2010 / 10:21

el comandante jr ( e-mail: )
Viernes 15.01.2010 / 15:55
H... uen a su P... madre pinches cholos P... si tienen muchos huevos porque no se disen todo de frente muy H... ones se enconden detras de una pinche computadora jajaja eso no es tener huevos eso se llama ser culos pinche bola de jarochos nacos tierrosos se nota que no son de juarez la gente de juarez nos desimos las cosas de frente no detras pinche bola de culos jajaja me dan risa pinches cholos culos P... att cartel de juarez nosotros si tenemos mas que huevos y lo emos demostrado a nivel mundial cartel de juarez.

( e-mail: )
Jueves 14.01.2010 / 14:25
me la estoy jalando

( e-mail: )
Jueves 14.01.2010 / 14:19
tengo comezon en los huevos kien me rasca

( e-mail: )
Jueves 14.01.2010 / 14:15
kiero saber cosas sobre el graffiti kn me ensea

el pancho ( e-mail: )
Jueves 14.01.2010 / 14:11
puro barrio minerotes 13

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 14:03
un saludo para todo el barrio funakisotes 13 el creiko, ramstein,makana, azul,sekia, asep y el milton puro vato pesado

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 14:00
y se los va a cargar la V... pinches tatos 13 ya los traemos en la mira amarrence para los plomazos

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 13:55
k tranza pinchis chavalotas aki el viruela rifando y controlando.. el viruelota de los funakis 16 putos sembrando terror por todo juaritos

( e-mail: )
Jueves 14.01.2010 / 10:21
H... en asumadre todos

( e-mail: )
Jueves 14.01.2010 / 09:46

b5ta sur ( e-mail: )
Jueves 14.01.2010 / 09:24
puro b5ta sur rifa putos rip kosi-devocker kiinteerotess suurr riifaandoo puutoos (el)(kiikee)

spanky ( e-mail: )
Jueves 14.01.2010 / 01:35
atodos los soldados y municipales se los ba a kargar la V... y sus familiares tambien ya dejen trabajar agusto atentamente mi patron los poluicias q estan demi lado ya la isieron los q no ya mamaron mexicles forever

acto otk ( e-mail: )
Jueves 14.01.2010 / 01:29
H... en sumadre todos los barrios entrados

( e-mail: )
Miércoles 13.01.2010 / 14:21
alosssJARUDOSS.loossmamo laa nettaaaa.

joma ( e-mail: )
Miércoles 13.01.2010 / 10:55
puro ns 14 rifa . el joma y la yaira rifan. norteños 14

( e-mail: )
Miércoles 13.01.2010 / 05:30
ADN rifa LOW,angel

pavis ( e-mail: )
Martes 12.01.2010 / 02:16
soy surreno tirando valas portodos pinchis l

( e-mail: )
Lunes 11.01.2010 / 11:48
ThE sOfErOnE!!!!

gato 14 ( e-mail: )
Lunes 11.01.2010 / 11:40
cccccchhhhhhhooooolllllleeeeee 111111111111111444444444444444 ttttttthhhhhhheeeeeee gggggaaaaaaaattttttttooooooooooo

collas ( e-mail: )
Lunes 11.01.2010 / 09:27
barrio santanas 18 cocha onde kiera

weroner ( e-mail: )
Lunes 11.01.2010 / 07:46
segundo barrio central rifa el weroner .chinoker .demo .kone .papy . miguel.lalo. pepe.dower. doker. luis .teto. ivan. liker .junior. pelon. alonzo. bebe. julio. sate. 0nersotezs

weroner ( e-mail: )
Lunes 11.01.2010 / 07:40
soy de el barrio mas H... on de cd juarez segundo barrio central mas conocido como la fe2chika central in memori of ronko tito cholo pesuñas descansen en paz

( e-mail: )
Domingo 10.01.2010 / 07:58
ia wossk ia wosssK HAHA

bjl ( e-mail: )
Domingo 10.01.2010 / 02:35
jjaaarrruuuudddooo lokos

@cmer ( e-mail: )
Sábado 09.01.2010 / 12:10
un saludo para todos mis compas los msk galeana para el host,kope,seko,oner,unick,fame,gasp,diablo,hamt,saico,smock,grifo,eroek,smash,kiko,soul,drack, serio,loco,mask,noe,y para todos los 19velarde del @cme de msk galeana mex side kings 4 ever and 4 life by @cme 675.

bjl ( e-mail: )
Sábado 09.01.2010 / 09:39
jajajajajaja pinchis ronosos cagados con cuete o sin cuete jarudo la rifa putos cagados

kimmy ( e-mail: )
Sábado 09.01.2010 / 06:17
este barrio es el mas fregon ps kien se meta con un cabron despertaras en un cajon lleno de balazos por mandilon kien te manda a dar catorrazos este barrio no es bromas vete con tu mami P... lloron

BJL- ( e-mail: )
Viernes 08.01.2010 / 15:08
hahahaKUALESS pinnchiss meniadoosss puuroo pinncchiii ROÑOOSSSOO NO CARNALL hahaha nommbrree CARNAL si usteddess estann lebanntadooss nosotroosss esttamooss LEVANTADOTTESS CABRONESS hahaa PUUALL pinnchi bajoo 21 BBAARIOOJARUDOTELKOSS!! qontrolanndoo laa quuestttass & TOODOO JUARITOOSS hahahahah PIINNCHISS ROÑOSSOSS hahahaha

( e-mail: )
Viernes 08.01.2010 / 14:54
ya ya no muchopinchi rollo pinchis jarudos no ammen tanto la V... los bajo 21 cochamos putas y si no pregunten por dodne kieran culones barrio bajo 21 controlando puro pinchi meniado

rps ( e-mail: )
Viernes 08.01.2010 / 13:20
ps que royo jarudo lokos rifandola como la ven

kiko ( e-mail: hnsfdhdhn )
Viernes 08.01.2010 / 08:44
que royo

( e-mail: )
Viernes 08.01.2010 / 05:31

LOW ( e-mail: )
Viernes 08.01.2010 / 05:17

doser ( e-mail: )
Viernes 08.01.2010 / 05:11

low ( e-mail: )
Viernes 08.01.2010 / 05:08
Saludos a todos los de la ADN de la federal 8 para el doser,aster,sney,drive,foster,sloker,flex,traner,sock,dilook,dream,ares,losni,diore,duker,gari,bow wow,sower,scrip,caliya ,del su compa el low se cocha a los pcl cuando quieran.

( e-mail: )
Jueves 07.01.2010 / 08:49
a huevo tosos lo yevamos en mente y corazon rip pelonsito

( e-mail: )
Jueves 07.01.2010 / 08:40

bjL ( e-mail: )
Jueves 07.01.2010 / 07:54
RIPP:SLIKKyyoosiittee carrgoo enn mi menntteeWEII: BJL.UNOS

BJL ( e-mail: )
Miércoles 06.01.2010 / 11:58

drex ( e-mail: julio_drex_bjl@hot.... )
Miércoles 06.01.2010 / 08:47
bjl lks cosha pts el drex lbp saludando a mi compa el stop y al wosk jarudote lks rifando como dise mi carnal el gun ... con jarudo no t entres ...q despues se me arepienten jajajaja y nomode q no si es la pura neta jaja ai tamos pa lo q gusten drex duda gun balak yesk wosk klen

drexxity ( e-mail: bjldrex12@hot.. )
Miércoles 06.01.2010 / 08:43
jaja q mi pinshes lomeranller estan bien cagadotes nadie los conose jaja pues el drex onert se los cosha ya se la sabes de el lado bajo peligroso crew del jarudote lks ai tamos mi jente pa lo q gusten .. jarudo lks jarudo haciendas riffando pts un saludo pa mis compillas los prs ai tamos mi gun klen stop

b jl ( e-mail: )
Miércoles 06.01.2010 / 05:42
un saludo a mis jarudos.... snaf slat skyt wosk yesk efyk diser spek daser duda sonik klen seck gun cuba kiro fiber side sode phat gary evil resko styk mago yosek homye yeison sow duke sona nomy nox free jajajarudo rifando putos JARUDOTE CONTROLANDO PUTOS

jarudote ( e-mail: )
Martes 05.01.2010 / 13:22
el woskersote one se los cocha lomeros de mierda

( e-mail: )
Martes 05.01.2010 / 13:12
a quien H... ados les disen culos primeru levanten su barrio chapetotes jarudo lokos bjl rps putos

( e-mail: )
Martes 05.01.2010 / 10:39
puro bla bla bla pinchis jaruchas de M... no mucho royo y mas accion pinchis culos

( e-mail: )
Martes 05.01.2010 / 10:30

Wosk ( e-mail: )
Martes 05.01.2010 / 10:06
Jarudotote lokos el jarudotote rifando donde qieran y a la V... Los ronosos del siete de la NHL

( e-mail: )
Martes 05.01.2010 / 06:07

slaT1 ( e-mail: )
Lunes 04.01.2010 / 14:00

eL PiStoLa ( e-mail: )
Domingo 03.01.2010 / 09:24
aki el pinche gun pa k wachen kana jarudote rifando y controlando a pura pinche chapete k no la kuaja JAJAJAJAJA lado bajo aki representa BJL

stop ( e-mail: )
Domingo 03.01.2010 / 09:00
pues q cholos jarudo asta la muerte cagados yasabe aytamos los dela unolos jarudo compa chida lbp

el canibal ( e-mail: )
Domingo 03.01.2010 / 08:57
la 18ta vatos de calfas yase la sabenputos la long beach de la heroes putos

BJL JARUDO ( e-mail: )
Domingo 03.01.2010 / 08:55

el juano ( e-mail: )
Domingo 03.01.2010 / 08:53
la playota 18 vatos la long beach xv3 putos

bjl ( e-mail: bjlstop )
Domingo 03.01.2010 / 08:46
el stop barrio JARUDO lks aytamos los dela lbp lado vajo peligroso pinches del siete y todos los entrados yo soy elstop y me la pelan cana el stop y el klens del jarudo lks con stilo men pinches raperos del siete estan vien cajados miados asi q ballanse ala V... hijosde P... pinches terrenosos miados y tanvien pa los ak47 cagados rmz cagados bgl cagados elstop bjl cabron

stop ( e-mail: )
Domingo 03.01.2010 / 08:40
sisi el stop bjl desde luego jarudo lokos men asi q vallanse al carajo el nox el kiro klens stop drex los rps lbop cochan sttop uno.,

sl?- ( e-mail: bjL. )
Domingo 03.01.2010 / 04:52

Domingo 03.01.2010 / 04:01

pobres13 el ALIVIANE ( e-mail: )
Domingo 03.01.2010 / 03:54

Domingo 03.01.2010 / 02:38

( e-mail: )
Sábado 02.01.2010 / 04:06

bjL ( e-mail: jarudotee lokotees )
Sábado 02.01.2010 / 02:41
para los lomeros del 7 si weei i luego la bici q les tumbamos el otro dia ii asta nos trajimos un cuete calibre 45 para qee no anden tirando su rollo pinches sieteros terrosos nomas para qee washen ni con cuete nos asen nada ii el otro meco con la cabeza abierta se la abrimos shida hahahahahaha de okis train cuete shavalas ni lo truenan ps awebo por eso se los qitamos por culones

( e-mail: )
Viernes 01.01.2010 / 07:07
jarudotote putos los pinchis tierrosos del siete no valen pa pora verga

( e-mail: )
Viernes 01.01.2010 / 05:11

kabeka ( e-mail: )
Jueves 31.12.2009 / 11:48
primero matemos a todos estos cholos sarnosos hijos de su perra madre

( e-mail: )
Jueves 31.12.2009 / 11:43
bbaarrioo JARUDOTTEE.

rocker ( e-mail: )
Jueves 31.12.2009 / 11:32
que se mueran todos los politicos hijos de la vertebra muertos de hambre,,matemos a todos esos perros del mal

HeLio!pB7 ( e-mail: )
Jueves 31.12.2009 / 07:28

HeLio!pB7 ( e-mail: )
Jueves 31.12.2009 / 07:24
jaja no mamen nomas andaba un wei ese dia i salierOn a madres en quanto lo vierOn ii a eso le llamas bombitas jaja pinshis letras quLeras pero alos 5 min ia estaban tashadOs jaja no sigan tirando su roio de q son vergas el SIETE los seguira qoshando pinshis nOgaLeros!

SECTA ( e-mail: JONA23485@HOTMAIL.COM )
Jueves 31.12.2009 / 01:17

Miércoles 30.12.2009 / 01:16

SUENOKER ( e-mail: SUENOkerone )
Martes 29.12.2009 / 14:08
todos H... en a su P... madre puro swk south side loco de la clonia obrera de parte del sueñokerone

( e-mail: )
Martes 29.12.2009 / 07:28
puuro pinchee ABARROOTES SANDY

kiikee b5terotes ( e-mail: )
Martes 29.12.2009 / 06:39
k tranza cha[etones b5ta sur los cocha putos representando kinterotes rifan pokos pero lokos

( e-mail: )
Martes 29.12.2009 / 03:33

BJL. ( e-mail: )
Martes 29.12.2009 / 02:12

( e-mail: )
Lunes 28.12.2009 / 09:53
jarudote lokos bjl potos controlando

( e-mail: )
Lunes 28.12.2009 / 09:49
pinchis chapetes jarudote lokos los del siete no valen verrga jarudote lokototes

resio ( e-mail: resioner )
Lunes 28.12.2009 / 09:16
no mucho pinche rollo pinches tatoos de M... ps si saben bien ke no valen V... jajaja

HeLio!pB7 ( e-mail: )
Lunes 28.12.2009 / 06:22
jajajajaja bla bla bla pura pinshi habLadera ustedes bn sabes eL siete lOs qOsha B7!

( e-mail: )
Domingo 27.12.2009 / 06:14

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 26.12.2009 / 08:07
jaja ke i los del siete ke segun eyos nos kochan i no se ke jaja mira pinches lepes!! kuando oien del jarudo salen corriendo asta por el metro noss tienen miedo korren los kuleroos!! ajjaja i el bleess de los unidos ke i el denek me la pela el crowe lo barro kn una sola manoo!!

tAtOoS 13 ( e-mail: tAtOoS13 sUrEñoSs lOkOs sUt )
Sábado 26.12.2009 / 06:32
ofa ese pinci barrio pedorro que ni quien los coche y ahi andan todos empinados pidiendo dverga de los tatoos jajajjajajajajaja a webo siganos mamando pinchis ofa cagados asi nos levantan mas weyes y si kieren calarse nomas caiganle son bienvenidos putos pa ke wachen comos alen pero de neta no pura pinchi habladera C... de todos modos ya savemso ke ni van a caer culones tatoos 13 los cochan putas rameras

BJL.- ( e-mail: )
Sábado 26.12.2009 / 06:32

gabo r.m ( e-mail: )
Sábado 26.12.2009 / 04:39
saludossssss aotdo juarez felis año 2010 que selapasen chidotaaaaaaaa jajajajajajajajajajajajajajajajaja

gabo r.m ( e-mail: )
Sábado 26.12.2009 / 04:27
q pedo putillos

727 ( e-mail: )
Sábado 26.12.2009 / 04:09

( e-mail: )
Viernes 25.12.2009 / 15:33

b hacienda ( e-mail: bb..hhh...aaaaaaaa. )
Viernes 25.12.2009 / 09:22
pinches tatoos de M... si me acuerdo de esa vez q vendieron los 2 carros al fierro para comprarc su mezcalito putos jajajajajajajajajaja eso ya paso ahora ya es otro royo putos cuando qieran putos la ofa 18 los cocha chavalas

nsl 18 putos ( e-mail: )
Viernes 25.12.2009 / 09:14
puro 18 pinchis msh de M... nos pelan la verga

( e-mail: )
Jueves 24.12.2009 / 09:51

SUENOKER ( e-mail: SUENOkerone )
Miércoles 23.12.2009 / 13:13
el barrio mas H... on es swk south side locos de la obrera k siempresta y estara para meterle la berga a todos los norcacas's ( e-mail: )
Miércoles 23.12.2009 / 10:44
arre me keep io le avismo ami crew.. de esto siruela zhida alos graffiteros d juaritoz.. cnk crew phss

( e-mail: )
Miércoles 23.12.2009 / 08:57

sTiLO unICo tAtOoS 13 ( e-mail: tAtOoS 13 cONrtRolAnDo tRvEz dE loS aÑOs )
Miércoles 23.12.2009 / 07:22
TAtOoS 13 kE nUNcA hEmOs cAiDo CoNtRolAnDo ToDo pRaDerAs y TaMbieN La CoLOniA aZTeKa NOmAs pA kE WaChEn lOs EnTRaDoS puRo pInCHi CHaViLLo JaJa No Se mEtAN cOn lOs BaRrIoS dfe La ViEjA eScUeLa PuRo RuCo De 30 aÑoS y hAsTa pOLiS kE sOn tAtOoS NOmAs pA kE wAcHeN tAtOoS 13 geNeRaCiON trAS gEnERaCioN

( e-mail: )
Miércoles 23.12.2009 / 07:22
k transa putos aki el shagy sote ç conectando con el topito y el ruso de los world five de tierra nueva y para la jen te de los wf1 de donde mismo

cholito ( e-mail: )
Miércoles 23.12.2009 / 06:41

( e-mail: )
Miércoles 23.12.2009 / 04:19
eeh jente ay que realizar una mega pinta aki en la citty ttodos los qe tengan aerosol en la sangre ay qe rayar el puente de la panamericana endonde pasan autos para el paso o para chihuahua los pinshis guashos kreen ke poeden kon los delinkuentes del aerosol pero nos la pelan el keep de los kms shida raza

cholito ( e-mail: )
Miércoles 23.12.2009 / 04:08

cholito ( e-mail: )
Miércoles 23.12.2009 / 03:57
ahora dominamos nosotros ADN EL CHOLITO saludos a la jente de los CVS 38 LOCOS,EL BURRO,SNEY,DILOCK,DREAM

SUENOKER ( e-mail: SUENOkerone )
Miércoles 23.12.2009 / 03:39

( e-mail: )
Miércoles 23.12.2009 / 02:22

g A t Y C k e R ! ( e-mail: k i N t A s u R ! )
Martes 22.12.2009 / 13:26
cke trnz puthos aki la ckinta sur representando torres del sur y sus colonias aledañas packe wachen aun seguimos con un pocko d power puthoss..!..un saludo pa mis carnalithos el fresh . cixen . clear . blin . kike .fresa .. arre puthoss..!

( e-mail: )
Lunes 21.12.2009 / 14:26
a la V... pinchis culos jarudo lokos se los cocha pinchis chapetes colos y te apoyo mi cklen el wosker

SUENOKER ( e-mail: SUENO )
Lunes 21.12.2009 / 13:05

( e-mail: )
Lunes 21.12.2009 / 03:01

free ( e-mail: )
Domingo 20.12.2009 / 17:34
al V... putos aki el jarudo controla el free se los cocha chavalas

carlitos ( e-mail: rsueno )
Domingo 20.12.2009 / 14:12
todos esos pinchis barrios de M... el mas H... on es SWK SOUTH SIDE DE LA OBRERA DE JUAREZ AUNK LE ARDA EL CULO

wosq ( e-mail: )
Domingo 20.12.2009 / 14:05
aqi estoy en el barrio jarudo lokos de la rps el woskersoteone saliendole por el barrio bjl

( e-mail: )
Domingo 20.12.2009 / 13:52
levantando jarudo lokos pinci popo cagado ye pinch violado del cuva qeeeeeeeeeeeeeeee

Domingo 20.12.2009 / 09:31

IGuAnA bArRiO JArUdOtE LokOs! ( e-mail: hAcIeNDAsS!14 nOrTH ! )
Domingo 20.12.2009 / 04:45
k TraNzA Aki eL iGUAnnA Y eL sCkoR RiFaNdO en HaCiEnDa uNIvErsIdAd pOkoS PeRo LoKOS BjL NoRth Ay esTamOs mi JeNtE uyUn SaLuDo pArA El choRe De loS 38c Ay eStamOs CaRnAl i paRa eL kRoW De LoS fKn DeLa chAveÑA I Al MiKE De LoS BaRrIo AlTo wEsTh SiDE aY tAmOs KaRnAleSI pArA lOs jArUdO cUesTa!!!! eL iGuaNaOnE DE bArRiO aLtO jArUdOS LokOS!!!

pb7 ( e-mail: )
Domingo 20.12.2009 / 03:40
el siete los qOsha HeliO el wisO eL fatH

efra ( e-mail: ondk )
Domingo 20.12.2009 / 03:33
mi mejor amigo es jhon i tiene una chamarra de cuero de ganso lo amo

( e-mail: )
Sábado 19.12.2009 / 13:02
los de la 18 son culototes los putos no valen V... putos y el bawer ke H... ue su madre puro msh kana1!!

josee lalo ( e-mail: )
Sábado 19.12.2009 / 09:05
pinzhes puthos io soe de los 30 i nosotros rifamos i controlamos puthos i no nos agan nada x qe nosotros somos qulos jajajajajajaja baes

( e-mail: )
Sábado 19.12.2009 / 07:54
ey bola de chabalas ya bajenle de huevooos, ya llego el negro de la xv3 rifando y controlando. y al wey ke no le paresca aki lo voy a estar esperando

( e-mail: .. )
Jueves 17.12.2009 / 13:43
. . o n e k o n e . . ! ! Ds.

slata- ( e-mail: RPS, )
Jueves 17.12.2009 / 09:44

chole XVI ( e-mail: )
Jueves 17.12.2009 / 08:56
Saludos a todos los chole XVI por que xten los hombres si valen V... pero quero qe sepan qe los chole son lo maximo ok

KINTEROS ( e-mail: )
Jueves 17.12.2009 / 07:05

el BUGGY EL SNAKE ( e-mail: )
Jueves 17.12.2009 / 05:49

( e-mail: )
Jueves 17.12.2009 / 05:20
elslat jarudolokoss rpss.putoss.

( e-mail: )
Miércoles 16.12.2009 / 12:43
ermanos x q se pelean amense unos a otros jajaaja yo los amo a todos vengan por mi y les dare amor a todos jajajaa estoi bien buena

( e-mail: )
Miércoles 16.12.2009 / 10:38

( e-mail: B'JL- )
Miércoles 16.12.2009 / 10:35

bJl! skoR! ( e-mail: b j l )
Miércoles 16.12.2009 / 09:47
sckor oner! cocha! y ala V... con los ke amenasan por internet al yesk jaja arre ay tamos barrio jarudo haciendas uno cuatro lokos!! pokos pero lokos!!!! bJl!

( e-mail: yesk )
Miércoles 16.12.2009 / 09:28
JaaRudoo el yeesk la neta no tengo miedo a nadie venganme ii matenme aqi los esperoo

tAtOoS 13 LOCKOS ( e-mail: TaToOs 13 lockos )
Miércoles 16.12.2009 / 06:43
jajjja se las pelamos oke jajjaaj maman mis chavillos si no la arman no valen V... niikiera pa gastar balas con ustedes no valen V... C... no les da verguenza levantar su barrio pedorro de 5 weyes jajajajajja maman chavillos jajaja tatoos 13 se los cochan saven bien pa ke se andan con M... noma ponganse a recordar cuando su barrio cagado le cayo para aca se fueron sin dos carros y con un P... todo fileriado de la cabeza P... tatoos 13 controla todo praderas y todo hacienda

*♫ô♫*mr Dreck ( e-mail: )
Miércoles 16.12.2009 / 06:29
puro cartel de juarez

kinteros ( e-mail: )
Miércoles 16.12.2009 / 05:34
kiintteroooteessss puuto0oss riiffaann

( e-mail: los # 1 )
Miércoles 16.12.2009 / 04:03

rp.s- ( e-mail: )
Miércoles 16.12.2009 / 03:18

bhacienda ( e-mail: el flow i el recio putos )
Miércoles 16.12.2009 / 02:42
mira C... para empesar aunq seamos 5 nos pelan la V... putos.......bbbbbbbb.hhhhhhh.aaaaaaaa aunq les cueste pinches tatoos de mierda.un saludo alos ondk de parajes del sol i a los ofak del 18 i alos cuatro 20

jarudolokos ( e-mail: draksillo )
Martes 15.12.2009 / 19:49
eso ke kulero por ke no pones kien eres as de ser un pinche lepe culon, no sabes a mlo ke le tiras B.JARUDO.LOKOS ELDRAKONERSOTE DEL LADO BAJO PELIGROSOTE CONTROLANDO UNSALUDO PALM KLEN AYTAMOS YA SABES BJLFOREVER

( e-mail: )
Martes 15.12.2009 / 18:57

( e-mail: )
Martes 15.12.2009 / 18:31
el snaaf esta de regresoooo hoooms jajaj BjL de vuelta lokoos ahoraa si viene lo bueno hahaha

tatoos 13 lockotes ( e-mail: tatoos13 )
Martes 15.12.2009 / 16:01
e neta me emperra esos pinchis rollos putos tiran much amierda pinchis bha( ke por cierto son como 5 jajaj si es ke kedan) neta P... no hablen y kaiganle pues pa ke wachen tatoos 13

drexxiti ( e-mail: )
Martes 15.12.2009 / 10:55
q tranas pinshes culos el dresxxiti de los jarudo nocturnos jaja un salido a mis compiyas los rps de el jarudo lks el drex bjl lbp ai estamos pa lo q gusten nenas

( e-mail: )
Lunes 14.12.2009 / 09:10

bhaciendota ( e-mail: el recio i el flowuoner )
Lunes 14.12.2009 / 08:35
vallance ala V... los sut los meniados jajajaja mas bien los miados putos nos pelan la V... putos jajaja uyuyui al tiro con los miadoz jajajaja

ttHee ssNiiCkQ! ( e-mail: CkiiNtteeRoossuuR! )
Domingo 13.12.2009 / 13:37
uuN ssaaLuuddoossCkY paaL CkiiCkee ' iiaa see Laa saaVee mee ccHaaVoo Ckee paa ssiieeMppRee Laa CkiiNttHaa ssuuR pooCkooss peeRoo LooCkooss eeN Laa meemooRiiaa ddeeL CkoozzY aaNdd deeVooCk Ckee eeN paazz ddeessCaaNsseeN ii aaH Laa VeeRgaa Looss Ckee nooss aaN ccHaapeettiiaaddoO dee RaattHoo see ttHoppaaRaaN bieeN ssaaveenn ' soomooss ffaamiiLiiaa suuReeÑaa..!

kinteros ( e-mail: )
Domingo 13.12.2009 / 06:11
k tranza chabalas aki los kinterotes surenotes rifando putos y controlando pocos pero lokos (b5ta)(sur) (forever) (rip) (koosii-deevoock)

Domingo 13.12.2009 / 03:54

EL DAFe ( e-mail: )
Sábado 12.12.2009 / 14:58

n0r ( e-mail: )
Sábado 12.12.2009 / 05:32
k ranza pinchez chabalaz ya sabemn k l0z nskgaliana l0s c0chan sanben k k0nr0lam0s de n0rte a n0rte

kinteros ( e-mail: )
Jueves 10.12.2009 / 16:36
no tiren mucho pinche royo putoss aqui los kinterotes sur rifando y ya culos b5ta sur {rip} {kosi-devock}

TaTooS 13 ( e-mail: sUtAtToS 13 )
Jueves 10.12.2009 / 12:36

el flow de la ofak del 18 ( e-mail: b.h.a )
Miércoles 09.12.2009 / 10:39
qe tranza de new el flower y el exa del barrio haciendota i de la ofak 420 del 18 putos jajajaa

( e-mail: bJL el yeskaaa )
Martes 08.12.2009 / 17:05
el yeesk wofe ii el duda de los cangri crews del jarudo coshan ii un saludo para mi carnalito skor de las haciendaas amarranese para q sientan el poder de todo ejercito jarudo los entradoos

jajajajajaja ( e-mail: exaktonersote )
Martes 08.12.2009 / 13:35
ke tranza pinche bola de chavalas esto va pra los pinches nenas de los bdr y tatoos 13 pra ke tiran tanto pinche roio si saben bien ke no valen V... ninguno de los dos barriesillos cagados si cuando c topan c tiran besos pinches nenas atte el exaktote barrio haciendas y el flow ofa 18 jajaja

bJl! skoR! ( e-mail: BJL )
Martes 08.12.2009 / 07:12
bJl . ScKoOrr! oNe ciTy Em!

Martes 08.12.2009 / 07:08

( e-mail: )
Martes 08.12.2009 / 05:47
pinchis choliyos cagaos

( e-mail: )
Lunes 07.12.2009 / 23:19
pff'' jeje lo encontre x error

el flow de la bha ( e-mail: puro haciendota )
Lunes 07.12.2009 / 18:07
que rrollo mi deack de los south park soi el flow de la bha

el flow de la bha ( e-mail: puro haciendota )
Lunes 07.12.2009 / 18:02
el denso de donde carnal

anonimo ( e-mail: anonim0o )
Lunes 07.12.2009 / 07:49
in memory of denso 1990-2009 qui con la gente

el deack ( e-mail: )
Domingo 06.12.2009 / 17:40
vallancen ala V... todos los sut i los luneros el deackeroner de los south parck de hacienda las torres

( e-mail: )
Sábado 05.12.2009 / 09:39

alex ( e-mail: )
Sábado 05.12.2009 / 05:43
18 rifa

alex ( e-mail: )
Sábado 05.12.2009 / 05:31

alex ( e-mail: )
Sábado 05.12.2009 / 05:21
ei k roio pos aki el grafitero d los santanas 18 ok ora

spoon ( e-mail: )
Viernes 04.12.2009 / 15:21

jarudolokos ( e-mail: drak )
Viernes 04.12.2009 / 14:35

joma ( e-mail: )
Jueves 03.12.2009 / 09:35
le joma y yaira kartel cronicos 312 la krocitos rifa kc

by joma ( e-mail: )
Jueves 03.12.2009 / 09:31
kartel cronicos 312 rifa el joma

kike ( e-mail: )
Jueves 03.12.2009 / 06:49
llo soy el mas H... on putos elkike kocha pinhes jpotos

( e-mail: bjL pcs 1 )
Miércoles 02.12.2009 / 20:26
principaleeeeeeees 1 jarudoooooooo locooooooos

jose ! ( e-mail: )
Miércoles 02.12.2009 / 05:17
eh puto0os ya dejense de P... y no anden de pinchisz ablado0res pende... si la ban a armar kaiganle pt0os pcs1!! ya se la saben put0os !!

La pp ( e-mail: )
Miércoles 02.12.2009 / 05:12
k roio0 AKI PAZANDO0 A ZALUDAR A LO0 k rifan y ko0ntro0la la cho0le 14 bueno0 zo0lo0 para k zepan kienz zon lo0 v. kuidence byeeee!!! in memo0ry o0f jjo0na te vamo0z a xtrañar________________________

erick ( e-mail: )
Martes 01.12.2009 / 11:27
soy el erick de aca de las cruces puros pan con leche crew pcl 725 crew fuck you all

exo0r nsg ( e-mail: )
Domingo 29.11.2009 / 15:01
q tranza puto0s el exo0r co0ntrolando0 la galeanota puro0 no0rth sidee 18 lo0ko0tes el exo0r i el so0re pts

( e-mail: )
Domingo 29.11.2009 / 12:18

eeL gaattHiiCk ooNee ( e-mail: b kiiNttHeeRooss ssuuR )
Domingo 29.11.2009 / 06:21
a la V... los ctwt ya ni existhen jaja.. i pz los hps1 caeganle pa ver ckienes son mas ckulos arres puthass..!K I N T E R O T E S !

( e-mail: )
Viernes 27.11.2009 / 07:18

( e-mail: )
Viernes 27.11.2009 / 07:01
in memory of denso te vamos a extrañar un H... o nunca olvides que te queremos muxo descansa en paz

el kikeonersote ( e-mail: )
Viernes 27.11.2009 / 05:58
los kinteros rifan pinches harpis culos b5terotes sur putos rip kosi devock

SPOON PCS1 ( e-mail: )
Viernes 27.11.2009 / 01:18

spoon ( e-mail: )
Viernes 27.11.2009 / 01:11

Slow ( e-mail: )
Jueves 26.11.2009 / 10:13

clow ( e-mail: )
Jueves 26.11.2009 / 04:26
puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow el clow.macho.cholo.beloz.baner.tanja cochan putos

soniK! IGUANA! BJL 14 ( e-mail: )
Miércoles 25.11.2009 / 15:31

cartelonsote 23 ( e-mail: harpisotes 1 )
Miércoles 25.11.2009 / 02:50
culos los kta bmt rmz tfk ssp bkl psk brl ylc usk bsp bdr sutatos pfk entre otras chavalas que no valen mas que pa pura verga

( e-mail: )
Martes 24.11.2009 / 16:50
barrio0 n0orth side diciocho0ta de la galeano0ta putho0s el exo0r so0re neto0 niclo0 dan axer so0uk so0ne flex mago0 fo0ke so0wy pens co0sm0o ro0yer so0l cro0w flo0mer ia pinches jarudo0s c0omo0 tiran ro0i0o puto0s el exo0r de la nsl 18 los cocha barrio no0rte puto0s

( e-mail: )
Martes 24.11.2009 / 13:42
fucking cobras of ep suck my dick like old the fuckin pouser in cd juarez like the gang pnl

DiiAaNiiThAa ( e-mail: .... )
Martes 24.11.2009 / 12:59
amorr virthuaal,,,, soloo speroo nuu bolbermee aa eqkiivooqkarr qkoontiwoo nethaa qkee speroo qkee noo me defraudess ii qkee noo stess usandoo todoo esoo nadamas paraa ndar qkonmiwo,,i dspoess mandarme alaa DIQK qkomo toodooss nethaa porfiiss iaa nu mee aghan mas dañoo..! PCS1

( e-mail: )
Martes 24.11.2009 / 11:35

( e-mail: )
Martes 24.11.2009 / 07:07
arres entrenle al chat de juarez pa ke se armen las riñas chidas

Martes 24.11.2009 / 06:58

Martes 24.11.2009 / 04:54

( e-mail: )
Martes 24.11.2009 / 02:58

snake baby dks 30 bsm 13 ( e-mail: )
Martes 24.11.2009 / 02:52
k transa cabrones el baby delos bsm y el snake 30 son H... ones H... uen a su madre el chino y el scrapy de la mb y todos sus punchis compas culos los hps3 los mochos 13 y los fta son chapetes culos mama pitos el baby bsm locotes northside ya saben donde estoy putos de M... pa cuando quieran culos

( e-mail: )
Lunes 23.11.2009 / 10:25
pobres 13 la jente del aliviane

el yoyitos ( e-mail: )
Lunes 23.11.2009 / 10:21
in memory of el yoyitos pobres 13

el aliviane ( e-mail: )
Lunes 23.11.2009 / 10:18
pobres 13 no ay pedo si andan los bck o4d cvs38 de roma ya les matamos 2 y al denso. el aliviane

para los cole14 ( e-mail: )
Lunes 23.11.2009 / 10:10
pobres 13 les dijimos q ivamos por los chole falta el cosilla fabian y el negrito los del aliviane ala V... el denso

DiiAaNiitHhAa ( e-mail: dianitha is very very happy.. )
Lunes 23.11.2009 / 03:36
jojo nuu tniiaa naada qkee aserr ii pss me pusee aa sqkriibirr qkashithoss deee qkancioneess qkee me gusthan mushooo .....aeaeaeaee dee laas mamiiss teeaam sholithaa dee laa PCS 1

DiiAaNiiThHaA ( e-mail: dianitaa iss very very happy )
Lunes 23.11.2009 / 03:30
ASI FUE (playa limbo) qkoomo lee dighoo kqee tee amoo ,,,,sii mee aa preegunthaadoo ioo lee dijee qkee nooo....¡Û ADIOS..(jesse & joy) duelee no teneerthee cerqkaa dueele noo senthirr thuu vooozz..! ESTAR EN THU MUNDO (reik n sin bandera) necesiithoo qke me loo digas ,,io qkieroo qke me lo digass qke mi amor segiraq kreciendoo mas & mass..! qkieroo qkee siempree seaas miaaa ...qkieroo saber si lo qke sienthes es profundooo..! PUTA DESAGRADESIDA (enriqke bunbury) NOO,,qkonoosqko aa naadiee qke mienthaa qkomoo thuu qkee qkoon tanta disiplinaa presisioon ii sinceridaadd,,te ganasthe thuu lugarr ..jjojo UN BUEN PERDEDOR..(sin bandera) naraanaaraa,,,see qkee piensaas marsharthe iaa lo see i no te detendree,,as lo qke tuu qkieraas sim embargo reqkuerdaa qke ioo staree akqee en el mismoo lugarr ii si solo tienes ganas dee ablarr qkon gusth te sqkusharee,-! ii sii el supo darthe mas amor supo ienarthe mas qke io,,qlaro ¢®qkee se perder qklaro qke se perder! pss nuu tngoo

dianitaa ( e-mail: )
Domingo 22.11.2009 / 13:55
auun tee amoww gathithoo ...,,,

eeL gaattiiCkeeR! ( e-mail: kiNtAsUr.cOntROLandO tOrreS deL suR )
Domingo 22.11.2009 / 13:41

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 21.11.2009 / 13:42

elkikeonersote ( e-mail: )
Sábado 21.11.2009 / 10:47
puro kinterotes surenotes putos b5ta torres del sur rifan in memori of kosi devock

( e-mail: )
Sábado 21.11.2009 / 05:58

( e-mail: oneQkeroner...Ds )
Viernes 20.11.2009 / 17:09
el ooneeek del Ds.....!!

kinteros sur ( e-mail: )
Viernes 20.11.2009 / 08:08
kiintterrottess lookoottess reepresentando puutoss

el nerocker {kike} ( e-mail: )
Viernes 20.11.2009 / 08:05
aqui los kinterotes dejando linea putos desde torres de sur b kinta sur rifa putos in memori of:kosi/devock

( e-mail: )
Viernes 20.11.2009 / 08:03
in memory of my love densen boy cvs 38 bck 14 by betty boop

( e-mail: )
Viernes 20.11.2009 / 07:58
y un saludo para todos los chole 14 y alos cvs 38 chidooo

( e-mail: )
Viernes 20.11.2009 / 07:54
na pz aqi deseandole a mi amor el denso de los cvs 38 qe descance en paz y qe siempre lo voy a amar como no se imagina descansa en paz mi amor by tu chata

el kike ( e-mail: )
Jueves 19.11.2009 / 07:55
el enrike putos

la paupau ( e-mail: )
Jueves 19.11.2009 / 05:55
esst es la paupau de aki de las cruces new mexico la mas H... ona del barrio!!!!!!!!!!!!!!!!!!!!!!!!!!

ACK))KREW ( e-mail: )
Jueves 19.11.2009 / 04:32

el pavis ( e-mail: )
Jueves 19.11.2009 / 04:13
el pavis el mas H... on puro barrio azulote de aka de zaragoza juaritos!!!!!!!!

HeLiO! ( e-mail: )
Miércoles 18.11.2009 / 15:53

SPAIK ( e-mail: )
Miércoles 18.11.2009 / 07:56

KEKO ( e-mail: )
Miércoles 18.11.2009 / 07:39

KIKE ( e-mail: )
Miércoles 18.11.2009 / 07:35

ARIANA ( e-mail: )
Miércoles 18.11.2009 / 07:27

SPAIK ( e-mail: )
Miércoles 18.11.2009 / 07:16

GRATE ( e-mail: )
Miércoles 18.11.2009 / 06:51

ysto ( e-mail: )
Miércoles 18.11.2009 / 06:36

SLOW ( e-mail: )
Miércoles 18.11.2009 / 06:18

ysto ( e-mail: )
Miércoles 18.11.2009 / 06:15

chikitos team ( e-mail: )
Miércoles 18.11.2009 / 06:08
en paz deskanse un gran compa ke lo keriamos y keremos muncho R.I.P oscar calderon herandez te vamos a extranar muncho!!!!!!!!!!!!!!!!!!!!! :( :(

pavis ( e-mail: )
Miércoles 18.11.2009 / 06:05
soy el slow de aca del barrio azulototote el mas H... onsote

mk ( e-mail: )
Miércoles 18.11.2009 / 05:54
el enrike

SNAKE30 ( e-mail: )
Miércoles 18.11.2009 / 01:56
EL KLEN COMO QUIERAS PINCHI PENDEJO DE MIERDA TU Y TU PINCHI GENTESITA ROÑOSA DONDE QUIERAAPUTO LOS JAROCHOS O COMO ES TU PINCHE BARRIO CAGAADO CHINGA TU PUTA MAdre cojida saludos para el axer y el mega del barrio alto el snake fose cause grove gogoño cui y el sopas H... ue su madre la golla

Foxy ( e-mail: )
Martes 17.11.2009 / 03:39

( e-mail: )
Domingo 15.11.2009 / 13:10
te vaas a morir pinche acme

jorge ( e-mail: )
Domingo 15.11.2009 / 09:26
Que onda my gente de los msk galeanota soy el acme saludos para todos mis compas tambien para los de la 19 velarde espero q se acuerden de my toda my gente H... ona saludos para el host,sek,oner,saico,mask,diablo,loco,unick,gasp,fame,kope,el noe,drack,hamt,eroek,smash,soul,kiko,spoke,saludos para todos ustds y los q me faltaron msk rifa alwais and forever *3l @cm3 msk*

dobladote amuete ( e-mail: )
Sábado 14.11.2009 / 12:57
q transa putos somos los vergotas de juarez controlando las calles para lospcs q vergera les quedo su rola doncellas m de marrenos puro pa delante jente

nOox ( e-mail: nox )
Sábado 14.11.2009 / 12:22
que rrollo putos jarudo lokos un saludo para el drak el nox controlando lbp

andy ( e-mail: el_ysto@hotmail )
Sábado 14.11.2009 / 09:39
los graffiteros mas H... ones de todo cd. juarez los pan con leche crew el ysto el esmo grate 725 crew se la rifan H... on para el arte graffitero

andy ( e-mail: el_ysto@hotmail )
Sábado 14.11.2009 / 09:22
soe el ysto de loz pan con leche crew 725

norte forever ( e-mail: norte loko el ARES )
Sábado 14.11.2009 / 07:23
que un saludo a toda mi jente norteñota alos del 72 alos sc de todo juaritoz y un saludito alos jarudillo ay estamos lokos

La pp ( e-mail: )
Sábado 14.11.2009 / 06:00
zaludo0s a lo0z de la cho0le 14 echenle ganazz... c sabe k ustedez rifan y ko0ntro0lan. en especial al fro0s

kike ( e-mail: )
Sábado 14.11.2009 / 02:55
pobres 13 rifa kul...

FrEDY!BaCkEr! BjL! ( e-mail: jArUdOtE HaCiEnDAS )
Sábado 14.11.2009 / 02:22
mire crowe ya mejor desafanete ke esta escopeta 12 no respeta a perros lambe huevos como tu P... tu ami no me sacas pero yo aty si asi que cuidate las espaldas que un dia de estos te quedas sobre el paimento P... i es de neta no es M... hom i para los msf el draw igual ia desafanese mijo ke tambien ya trampamo una eskopeta 6tiros expansivos asi que amarrense i para los msh ya ni quien loss aga en la vida ya superenos! jaja de ustedes ya ni nos akordamos jajja pero si quieren pedos de nuevo pues arre traigo muchos tiros para defende ami jente o pa cubrir al backersiyo BJL HACIENDAS FREDY LOKOTE BACKER Y EL SKOR! ARRE!

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 14.11.2009 / 02:17

( e-mail: )
Viernes 13.11.2009 / 07:20